alerta Si el documento se presenta incompleto en el margen derecho, es que contiene tablas que rebasan el ancho predeterminado. Si es el caso, haga click aquí para visualizarlo correctamente.
 
DOF: 28/09/2022

CONVENIO Específico en materia de transferencia de recursos federales con el carácter de subsidios, para fortalecer la ejecución y desarrollo del programa y proyectos federales de Protección contra Riesgos Sanitarios, así como de la Red Nacional de Laboratorios, correspondiente al ejercicio fiscal 2022, que celebran la Secretaría de Salud y el Estado de Colima.

COFEPRIS-CETR-COL.-07-22

CONVENIO ESPECÍFICO EN MATERIA DE TRANSFERENCIA DE RECURSOS FEDERALES CON EL CARÁCTER DE SUBSIDIOS, QUE CELEBRAN POR UNA PARTE, EL EJECUTIVO FEDERAL, POR CONDUCTO DE LA SECRETARÍA DE SALUD, A LA QUE EN ADELANTE SE LE DENOMINARÁ LA SECRETARÍA, A TRAVÉS DEL DR. ALEJANDRO ERNESTO SVARCH PÉREZ, COMISIONADO FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, ASISTIDO POR LA C. ANAHI GUADALUPE OROZCO, SECRETARIA GENERAL DE LA COMISIÓN FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS Y, POR LA OTRA, EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, AL QUE EN LO SUCESIVO SE LE DENOMINARÁ LA ENTIDAD, REPRESENTADO POR LA C. FABIOLA VERDUZCO APARICIO, EN SU CARÁCTER DE SECRETARIA DE PLANEACIÓN, FINANZAS Y ADMINISTRACIÓN, LA DRA. MARTHA JANETH ESPINOSA MEJÍA, EN SU CARÁCTER DE SECRETARIA DE SALUD Y PRESIDENTA EJECUTIVA DE LOS SERVICIOS DE SALUD DEL ESTADO DE COLIMA, CON LA ASISTENCIA DE LA COMISIONADA ESTATAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, DRA. TANIA IRERÍ RÍOS CUEVAS, A QUIENES SE LES DENOMINARÁ LAS PARTES CUANDO ACTÚEN DE FORMA CONJUNTA, CONFORME A LOS ANTECEDENTES, DECLARACIONES Y CLÁUSULAS SIGUIENTES:

ANTECEDENTES

I. Con fecha 10 de octubre de 2012, LA SECRETARÍA y LA ENTIDAD celebraron el Acuerdo Marco de Coordinación, en lo sucesivo EL ACUERDO MARCO, con objeto de facilitar la concurrencia en la prestación de servicios en materia de salubridad general, así como para fijar las bases y mecanismos generales a través de los cuales serían transferidos, mediante la suscripción del instrumento específico correspondiente, recursos presupuestarios federales, insumos y bienes a LA ENTIDAD, para coordinar su participación con el Ejecutivo Federal, en términos del artículo 9 de la Ley General de Salud.

II. De conformidad con lo estipulado en la Cláusula Segunda de EL ACUERDO MARCO, los instrumentos consensuales específicos que LAS PARTES suscriban para el desarrollo de las acciones previstas en el mismo, serán formalizados por, LA ENTIDAD, por la Secretaria de Finanzas y Administración (hoy Secretaria de Planeación, Finanzas y Administración) y, la Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, asistida por la Comisionada Estatal para la Protección contra Riesgos Sanitarios; en tanto que por LA SECRETARÍA, se suscribirá, entre otros servidores públicos, por el Comisionado Federal para la Protección contra Riesgos Sanitarios, asistido por la Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios.

III. En cumplimiento a lo dispuesto por el artículo 18 de la Ley General de Salud, el 30 de septiembre de 2016, el Ejecutivo Federal por conducto de LA SECRETARÍA y LA ENTIDAD suscribieron el Acuerdo de Coordinación, que tiene por objeto establecer los términos y condiciones en que se dará la coordinación entre LA SECRETARÍA y LA ENTIDAD para el ejercicio de facultades en materia de control y fomento sanitario que les corresponde ejercer.

DECLARACIONES

I. LA SECRETARÍA declara que:

I.1 La Comisión Federal para la Protección contra Riesgos Sanitarios es un órgano desconcentrado, por el que ejerce las atribuciones que la Ley General de Salud, la Ley Orgánica de la Administración Pública Federal y demás ordenamientos aplicables le confieren en materia de regulación, control y fomento sanitario; el cual cuenta con autonomía técnica, administrativa y operativa, de conformidad con lo dispuesto en los artículos 17 bis y 17 bis 1 de la Ley General de Salud; así como 1 y 3 del Reglamento de la Comisión Federal para la Protección contra Riesgos Sanitarios.

I.2 Dentro de las atribuciones que ejerce por conducto de la Comisión Federal para la Protección contra Riesgos Sanitarios, se encuentran las de efectuar la evaluación de riesgos a la salud en las materias de su competencia; instrumentar la política nacional de protección contra riesgos sanitarios en materia de medicamentos, insumos para la salud y sustancias tóxicas o peligrosas para la salud; ejercer el control y la vigilancia sanitaria de los productos señalados, de las actividades relacionadas con éstos y de los establecimientos destinados al proceso de dichos productos; evaluar, expedir o revocar las autorizaciones de los productos citados y de los actos de autoridad que para la regulación, en el control y fomento sanitario se establecen o deriven de la Ley General de Salud, así como imponer sanciones y aplicar medidas de seguridad, en las materias de su competencia, de conformidad con lo previsto por el artículo 17 bis de la Ley General de Salud y 3, fracciones I, VII y X del Reglamento de la Comisión Federal para la Protección contra Riesgos Sanitarios.

I.3 El Dr. Alejandro Ernesto Svarch Pérez, fue designado Comisionado Federal para la Protección contra Riesgos Sanitarios, mediante nombramiento de fecha 17 de febrero de 2021, expedido por el Presidente de los Estados Unidos Mexicanos, Lic. Andrés Manuel López Obrador, y tiene la competencia y legitimidad para suscribir el presente Convenio Específico, de conformidad con lo previsto en los artículos 2, inciso C, fracción X, 36 y 38, fracción V del Reglamento Interior de la Secretaría de Salud; 10, fracciones XVI y XVII del Reglamento de la Comisión Federal para la Protección contra Riesgos Sanitarios.

I.4 La C. Anahi Guadalupe Orozco, Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, participa en la suscripción del presente Convenio Específico, en términos del artículo 19, fracción XV del Reglamento de la Comisión Federal para la Protección contra Riesgos Sanitarios.

I.5 Cuenta con la disponibilidad de recursos para hacer frente a los compromisos derivados de la suscripción del presente instrumento jurídico, en términos del oficio No. DGPyP-0214-2022, emitido por el Director General de Programación y Presupuesto de la Unidad de Administración y Finanzas de la Secretaría de Salud, relacionado con el oficio No. 801.1.-05, emitido por la Subsecretaría de Egresos de la Secretaría de Hacienda y Crédito Público, por el que se autoriza a favor de la Comisión Federal para la Protección contra Riesgos Sanitarios, un Acuerdo de Ministración de Recursos (Acuerdo de Ministración), para que dicho órgano desconcentrado efectúe los procedimientos de contratación, transferencias a entidades federativas y pagos a proveedores de bienes y servicios, entre los que se contemplan los recursos a transferir con motivo del presente Convenio Específico.

I.6 Para todos los efectos jurídicos relacionados con este Convenio Específico señala como su domicilio el ubicado en calle Oklahoma número 14, colonia Nápoles, demarcación territorial Benito Juárez, código postal 03810, en la Ciudad de México.

II. LA ENTIDAD declara que:

II.1 La C. Fabiola Verduzco Aparicio, fue designada por la Gobernadora Constitucional del Estado de Colima, mediante nombramiento de fecha 1 de noviembre de 2021, Secretaria de Planeación, Finanzas y Administración y, por tanto tiene la competencia y legitimidad para suscribir el presente Convenio Específico, de conformidad con lo dispuesto en los artículos 60, 61, 66 y 110 de la Constitución Política del Estado Libre y Soberano de Colima; 1, 8, 17, fracción III, 22 y 35 de la Ley Orgánica del Poder Ejecutivo y de la Administración Pública del Estado de Colima.

II.2 La Dra. Martha Janeth Espinosa Mejía , fue designada por la Gobernadora Constitucional del Estado de Colima , mediante nombramiento de fecha 1 de noviembre de 2021, Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima y, por tanto tiene la competencia y legitimidad para suscribir el presente Convenio Específico, de conformidad con lo dispuesto en los artículos 60, 61 y 66 de la Constitución Política del Estado Libre y Soberano de Colima; 1, 6, 17, fracción VII, 22 y 39, fracciones VI y XXIII, de la Ley Orgánica del Poder Ejecutivo y de la Administración Pública del Estado de Colima ; 9o, fracciones I, IX, y XVI, del Decreto No. 227, publicado en el Periódico Oficial El Estado de Colima el 26 de octubre de 1996; 12, numeral 1 fracción II, 25 numeral 1, 26 numeral 1, fracciones I, III y XXIV, del Reglamento Interior del Organismo Público Descentralizado Servicios de Salud del Estado de Colima.

II.3 La Dra. Tania Irerí Ríos Cuevas, fue designada Comisionada Estatal para la Protección contra Riesgos Sanitarios , mediante nombramiento de fecha 17 de noviembre de 2021 y, por tanto, participa en la suscripción del presente instrumento jurídico, de conformidad con los artículos 9, numeral 1, fracción V, 27, numeral 1, fracción III, inciso a y 103 del Reglamento Interior del Organismo Público Descentralizado Servicios de Salud del Estado de Colima.

II.4 Dentro de las funciones de la Comisionada Estatal para la Protección contra Riesgos Sanitarios, se encuentran las de ejercer el control, vigilancia y fomento sanitarios en materia de salubridad general, concurrentes y local, orientando sus acciones a la protección y promoción de la salud pública, así como a la prevención de riesgos sanitarios, de conformidad con lo establecido en el artículos 9, 102, 110 y 103 del Reglamento Interior del Organismo Público Descentralizado Servicios de Salud del Estado de Colima.

II.5 Entre sus prioridades, en materia de salud, se encuentra el fortalecimiento de la ejecución y desarrollo del programa y proyectos federales de protección contra riesgos sanitarios, así como de la Red Nacional de Laboratorios.

II.6 Para todos los efectos jurídicos relacionados con este Convenio Específico señala como su domicilio el ubicado en calle Reforma, número 37, colonia Centro, código postal 28000, en la Ciudad de Colima, Colima.

III. La UNIDAD EJECUTORA declara que:

III.1 De conformidad con EL ACUERDO MARCO, la Dra. Martha Janeth Espinosa Mejía, titular del Organismo Público Descentralizado denominado Servicios de Salud del Estado de Colima, tiene la competencia y legitimidad para suscribir el presente Convenio Específico en su carácter de UNIDAD EJECUTORA, según con lo previsto en los artículos 1 y 46 de la Ley Orgánica del Poder Ejecutivo y de la Administración Pública del Estado de Colima , cargo que queda debidamente acreditado con el nombramiento de fecha 1 de noviembre de 2021.

Una vez expuesto lo anterior y toda vez que la Ley Federal de Presupuesto y Responsabilidad Hacendaria, dispone en sus artículos 74 y 75, que los titulares de las dependencias y entidades, con cargo a cuyos presupuestos se autorice la ministración de subsidios y transferencias, serán responsables, en el ámbito de sus competencias, de que éstos se otorguen y ejerzan conforme a las disposiciones generales aplicables, y que dichos subsidios y transferencias deberán sujetarse a los criterios de objetividad, equidad, transparencia, publicidad, selectividad y temporalidad que en dicho ordenamiento se señalan, celebran el presente Convenio Específico, al tenor de las siguientes:

CLÁUSULAS

PRIMERA. OBJETO.- El presente Convenio Específico y sus Anexos 1, 2, 3, 4 y 5, que firmados por LAS PARTES , forman parte integrante del mismo, tienen por objeto transferir recursos federales a LA ENTIDAD, con el carácter de subsidios, que le permitan, en términos de los artículos 9o., 13, 17 bis, 18 párrafo segundo y 19 de la Ley General de Salud, coordinar su participación con el Ejecutivo Federal durante el ejercicio fiscal 2022, a fin de fortalecer la ejecución y desarrollo del programa y proyectos federales de Protección contra Riesgos Sanitarios, así como de la Red Nacional de Laboratorios, de conformidad con los Anexos del presente instrumento jurídico.

Para efecto de lo anterior, LAS PARTES convienen en sujetarse expresamente a las estipulaciones de EL ACUERDO MARCO, cuyo contenido se tiene por reproducido en el presente Convenio Específico como si a la letra se insertasen, así como a las demás disposiciones jurídicas aplicables.

SEGUNDA. TRANSFERENCIA.- Para la realización de las acciones objeto del presente Convenio Específico, LA SECRETARÍA, por conducto de la Comisión Federal para la Protección contra Riesgos Sanitarios, transferirá a LA ENTIDAD, con el carácter de subsidios, recursos federales que se aplicarán exclusivamente al ejercicio de las acciones contenidas en los programas institucionales y por los importes que se indican a continuación:

PROGRAMA INSTITUCIONAL

FUENTE DE FINANCIAMIENTO

IMPORTE

Consolidar la Operación de las Áreas de Protección contra Riesgos Sanitarios

(Regulación y Fomento Sanitarios)

Ramo 12

$4,906,074.00

(CUATRO MILLONES NOVECIENTOS SEIS MIL SETENTA Y CUATRO PESOS 00/100 M.N.)

Consolidar la Red Nacional de Laboratorios de Salud Pública (Laboratorio Estatal de Salud Pública)

Ramo 12

$3,270,715.00

(TRES MILLONES DOSCIENTOS SETENTA MIL SETECIENTOS QUINCE PESOS 00/100 M.N.)

TOTAL

$8,176,789.00

(OCHO MILLONES CIENTO SETENTA Y SEIS MIL SETECIENTOS OCHENTA Y NUEVE PESOS 00/100 M.N.)

LAS PARTES acuerdan que la transferencia de los recursos federales a que se refiere la presente Cláusula, será única y estará condicionada a que LA ENTIDAD acredite que los recursos federales transferidos en el ejercicio anterior y sus rendimientos financieros, hayan sido ejercidos o, en su caso, reintegrados en su totalidad, en los términos y plazos que se señalan en el artículo 17 de la Ley de Disciplina Financiera de las Entidades Federativas y los Municipios, así como, de conformidad con las estipulaciones del presente Convenio Específico.

La transferencia a que se refiere la presente Cláusula se efectuará dentro de los sesenta (60) días hábiles siguientes a la fecha en que LA ENTIDAD entregue a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, el presente Convenio Específico debidamente firmado, siempre y cuando se cumpla con la condición señalada en el párrafo anterior.

Para tal efecto, LA ENTIDAD, a través de su Secretaría de Planeación, Finanzas y Administración , procederá a abrir, en forma previa a su radicación, una cuenta bancaria productiva, única y específica para este Convenio Específico, en la institución de crédito bancaria que determine, con la finalidad de que dichos recursos y sus rendimientos financieros estén debidamente identificados.

Una vez que sean radicados los recursos federales en la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD, ésta se obliga a ministrarlos íntegramente, junto con los rendimientos financieros que se generen, dentro de los cinco (5) días hábiles siguientes a su recepción, a la UNIDAD EJECUTORA. Asimismo, una vez concluido el mes en que se haya realizado la transferencia, deberá identificar y remitir a LA SECRETARÍA a manera de informe, mediante oficio; el estado de cuenta bancario y los rendimientos financieros generados. La UNIDAD EJECUTORA deberá informar mediante oficio a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, dentro de los cinco (5) días hábiles siguientes a aquél en que concluya el plazo anterior, el monto, la fecha y el importe de los rendimientos generados que le hayan sido ministrados. Para tal efecto, LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, dará aviso a la UNIDAD EJECUTORA de esta transferencia.

La UNIDAD EJECUTORA deberá, previamente a la ministración de los recursos por parte de la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD, abrir una cuenta bancaria productiva, única y específica para este Convenio Específico, a lo cual no se podrá aperturar otro tipo de cuenta, ni transferir lo ministrado a otras cuentas. En caso de incumplimiento a lo dispuesto en el presente párrafo, LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, estará en aptitud de suspender o cancelar las subsecuentes ministraciones de subsidios.

La no ministración de los recursos por parte de la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD a la UNIDAD EJECUTORA en el plazo establecido en el párrafo quinto de esta Cláusula, se considerará incumplimiento del presente instrumento jurídico y será causa para que la UNIDAD EJECUTORA comunique tal situación a los Órganos Fiscalizadores competentes para su intervención, quienes deberán solicitar el pago inmediato a la UNIDAD EJECUTORA o el reintegro de los recursos transferidos, así como el de los rendimientos financieros obtenidos, a la Tesorería de la Federación. Asimismo, en caso del incumplimiento, LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, estará en aptitud de suspender o cancelar las subsecuentes ministraciones de subsidios.

De igual manera, la UNIDAD EJECUTORA, dentro de los cinco (5) días hábiles siguientes a aquel en que le hayan ministrado los recursos federales, deberá realizar de conformidad con las disposiciones jurídicas aplicables, las acciones necesarias a efecto de que la Comisión Estatal para la Protección contra Riesgos Sanitarios i nicie las actividades específicas contenidas en el Anexo 2 del presente Convenio Específico, informando a su vez de dichas acciones a los quince (15) días hábiles a más tardar a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios.

Los recursos federales que se transfieran en los términos de este Convenio Específico no pierden su carácter federal, por lo que su asignación, ejercicio, ejecución y comprobación deberán sujetarse a las disposiciones jurídicas federales aplicables.

Queda expresamente estipulado, que las transferencias de recursos otorgadas con base en el presente Convenio Específico, no son susceptibles de presupuestarse en los ejercicios fiscales siguientes, por lo que no implican el compromiso de transferencias posteriores, en ejercicios fiscales subsecuentes con cargo al Ejecutivo Federal, para el pago de cualquier gasto que pudiera derivar del objeto del mismo.

TERCERA. VERIFICACIÓN DEL DESTINO DE LOS RECURSOS FEDERALES.- Para asegurar la transparencia en la aplicación y comprobación de los recursos federales ministrados, LAS PARTES convienen en sujetarse a lo siguiente:

I. LA SECRETARÍA, por conducto de la Comisión Federal para la Protección contra Riesgos Sanitarios, dentro del marco de sus atribuciones y a través de los mecanismos que esta última implemente para tal fin, verificará a través de la evaluación del cumplimiento de los objetivos, actividades específicas, indicadores y metas a que se refiere la Cláusula Cuarta de este Convenio Específico, que los recursos federales señalados en la Cláusula Segunda, sean destinados únicamente para cubrir el objeto del presente instrumento jurídico, sin perjuicio de las atribuciones que en la materia correspondan a otras instancias competentes del Ejecutivo Federal.

II. LA SECRETARÍA transferirá los recursos federales a que se refiere la Cláusula Segunda de este Convenio Específico, absteniéndose de intervenir en el procedimiento de asignación de los contratos o de cualquier otro instrumento jurídico que formalice LA ENTIDAD, para cumplir con el objeto de este Convenio Específico, y sin interferir de forma alguna en el procedimiento y, en su caso, mecanismo de supervisión externo que defina LA ENTIDAD durante la aplicación de los recursos presupuestarios destinados a su ejecución y demás actividades que se realicen para el cumplimiento de las condiciones técnicas, económicas, de tiempo, de cantidad y de calidad contratadas a través de LA ENTIDAD.

III. LA ENTIDAD, dentro de los primeros diez (10) días hábiles siguientes al término de cada mes que se reporte, enviará el informe detallado sobre el ejercicio, destino y los resultados obtenidos con los recursos transferidos en virtud del presente instrumento jurídico, así como pormenorizado sobre el avance financiero y copia del estado de cuenta bancario, mediante el cual deberá identificar e informar las transferencias o erogaciones realizadas y los rendimientos financieros generados. Dicho informe se rendirá conforme al formato denominado Avance Físico-Financiero 2022, que se adjunta al presente instrumento como Anexo 3, al que deberá acompañarse copia legible de la documentación justificatoria y comprobatoria correspondiente o, en su caso, un disco compacto que contenga copia digital legible de dicha documentación; así como el estado de cuenta bancario al que se hace referencia. En virtud de ello, el Avance Físico-Financiero 2022 que presente LA ENTIDAD, deberá corresponder con los CFDI y la copia del estado de cuenta bancario respectivo.

En el informe mensual a que se refiere la presente fracción, sólo se señalarán los recursos efectivamente ejercidos durante el mes que se reporta. En el supuesto de que en un mes no se ejercieran recursos, el informe se enviará en ceros, acompañado de una justificación que sustente las razones por las que no fueron ejercidos recursos en el mismo. El cómputo del primer mes a informar, comenzará a partir de la fecha de realización de la transferencia de recursos a LA ENTIDAD.

LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, podrá en todo momento, verificar en coordinación con LA ENTIDAD, la documentación que permita observar el ejercicio de los recursos presupuestarios federales transferidos a LA ENTIDAD, así como sus rendimientos financieros generados y podrá solicitar a esta última los documentos que justifiquen y comprueben el ejercicio de dichos recursos.

Es responsabilidad de LA ENTIDAD que la documentación comprobatoria y justificativa del gasto cumpla con la normatividad fiscal.

Asimismo, LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, verificará aleatoriamente los comprobantes digitales emitidos por el SAT que le sean presentados por LA ENTIDAD.

IV. LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, considerando su disponibilidad de personal y presupuestaria, podrá practicar visitas de verificación, a efecto de observar el cumplimiento de las obligaciones establecidas en el presente instrumento jurídico, así como que los recursos federales transferidos con motivo del mismo, sean destinados únicamente para el cumplimiento de su objeto.

V. LAS PARTES acuerdan que, en caso de incumplimiento en la comprobación de los recursos federales que sean transferidos a LA ENTIDAD, así como en la entrega de los informes y documentación correspondiente, LA SECRETARÍA, conforme a lo dispuesto por el artículo 223 del Reglamento de la Ley Federal de Presupuesto y Responsabilidad Hacendaria, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, estará en aptitud de suspender o cancelar la subsecuente ministración de recursos públicos federales, dando aviso de inmediato a las autoridades fiscalizadoras competentes de dicha omisión.

VI. Los recursos presupuestarios federales que LA SECRETARÍA se compromete a transferir a LA ENTIDAD, estarán sujetos a la disponibilidad presupuestaria y a las autorizaciones correspondientes, de conformidad con las disposiciones jurídicas aplicables y de acuerdo con el calendario que para tal efecto se establezca.

CUARTA. OBJETIVOS, ACTIVIDADES ESPECÍFICAS, INDICADORES Y METAS.- LAS PARTES convienen en que los objetivos, actividades específicas, indicadores y metas de las acciones que se realicen para el cumplimiento del objeto del presente instrumento jurídico, son los que se detallan en su Anexo 2.

QUINTA. APLICACIÓN DE LOS RECURSOS.- Los recursos federales a los que alude la Cláusula Segunda de este instrumento jurídico y los rendimientos financieros que éstos generen, se destinarán en forma exclusiva para fortalecer la ejecución y desarrollo del programa y proyectos federales de Protección contra Riesgos Sanitarios y de la Red Nacional de Laboratorios, en los términos previstos en el presente Convenio Específico.

Dichos recursos serán aplicados con base en el Anexo 5 Catálogo de Insumos que genere LA SECRETARÍA, a través de las unidades administrativas competentes de la Comisión Federal para la Protección contra Riesgos Sanitarios y, la Comisionada Estatal para la Protección contra Riesgos Sanitarios, el cual debidamente firmado por las instancias que celebran el presente Convenio Específico forma parte integral del mismo; tomando como referencia el Clasificador por objeto del Gasto para la Administración Pública Federal vigente. Dichos recursos no podrán traspasarse a otros conceptos de gasto diversos al objeto del presente instrumento jurídico. En el supuesto de requerir modificaciones en el Catálogo de referencia, éstas deberán ser solicitadas durante la vigencia del presente instrumento jurídico.

El Anexo 5 Catálogo de Insumos además, será sustanciado y validado conforme a la Memoria de Cálculo que genere LA ENTIDAD y valide LA SECRETARÍA a través de las unidades administrativas competentes de la Comisión Federal para la Protección contra Riesgos Sanitarios y, el Comisionado Estatal para la Protección contra Riesgos Sanitarios , la cual deberá ser firmada y avalada por quienes participen en su elaboración, revisión, autorización, y en su caso modificación o actualización. Dicha Memoria de Cálculo servirá como base para la revisión de la documentación de pago, que soporta la aplicación de los recursos.

Los recursos federales que se transfieren, se devengarán conforme a lo establecido en el artículo 175 del Reglamento de la Ley Federal de Presupuesto y Responsabilidad Hacendaria; se registrarán por LA ENTIDAD en su contabilidad de acuerdo con las disposiciones jurídicas aplicables y se rendirán en su Cuenta Pública, sin que por ello pierdan su carácter federal, por lo que su asignación, ejercicio, ejecución y comprobación deberá sujetarse a las disposiciones federales aplicables.

Los recursos federales transferidos a LA ENTIDAD que al 31 de diciembre de 2022 no hayan sido devengados, deberán ser reintegrados en su totalidad a la Tesorería de la Federación, en los términos del artículo 17 de la Ley de Disciplina Financiera de las Entidades Federativas y los Municipios, debiendo informarlo a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, de manera escrita y con los documentos soporte correspondientes; dichos reintegros deberán incluir los rendimientos financieros generados.

SEXTA. GASTOS ADMINISTRATIVOS.- LAS PARTES convienen en que los gastos administrativos que deriven del cumplimiento del presente instrumento jurídico, deberán ser realizados por LA ENTIDAD con cargo a sus recursos.

SÉPTIMA. OBLIGACIONES DE LA ENTIDAD.- Adicionalmente a los compromisos establecidos en EL ACUERDO MARCO y en el presente Convenio Específico, LA ENTIDAD se obliga a:

I. Vigilar el cumplimiento estricto de las disposiciones jurídicas aplicables al ejercicio del gasto público federal, dando aviso a las instancias respectivas por cualquier anomalía detectada, conforme a lo establecido en la normativa aplicable, por conducto de la UNIDAD EJECUTORA, responsable ante LA SECRETARÍA del adecuado ejercicio y comprobación de los recursos objeto del presente instrumento jurídico.

II. Responder por la integración y veracidad de la información técnica y financiera que presenten para el cumplimiento de los compromisos establecidos en el presente instrumento jurídico, particularmente, de aquélla generada con motivo de la aplicación, seguimiento, control, rendición de cuentas y transparencia de los recursos federales transferidos, en términos de las disposiciones jurídicas aplicables.

III. Remitir por conducto de la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD, a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, en un plazo no mayor a diez (10) días hábiles posteriores al cierre de mes, en el cual se hayan recibido los recursos federales que se detallan en el presente Convenio Específico, el CFDI conforme a la normatividad aplicable y el estado de cuenta bancario en el cual deberá identificar los rendimientos generados.

Asimismo, la UNIDAD EJECUTORA deberá remitir a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, mediante oficio, en un plazo no mayor a diez (10) días hábiles posteriores al cierre de mes en el cual se realizó la recepción de la ministración por parte de la Secretaría de Planeación, Finanzas y Administración , de LA ENTIDAD, el estado de cuenta bancario que acredite la recepción de dichas ministraciones y deberá informar los rendimientos financieros que le hayan sido ministrados, conforme a la normativa aplicable.

La documentación comprobatoria a que se refieren los párrafos anteriores deberá ser expedida a nombre de la Secretaría de Salud/Comisión Federal para la Protección contra Riesgos Sanitarios; precisar el monto de los recursos transferidos; señalar las fechas de emisión y de recepción de los recursos; precisar el nombre del programa institucional y los conceptos relativos a los recursos federales recibidos. Dicha documentación deberá remitirse en archivo electrónico Comprobante Fiscal Digital por Internet (CFDI), junto con los estados de cuenta bancarios que acrediten la recepción de dichos recursos.

IV. Integrar la información financiera relativa a los recursos federales transferidos para la ejecución del objeto del presente Convenio Específico, en los términos previstos en el artículo 70 de la Ley General de Contabilidad Gubernamental.

V. Aplicar los recursos federales transferidos y sus rendimientos financieros, conforme a los programas, proyectos, objetivos, actividades específicas, indicadores, metas y calendarización previstos en el presente instrumento jurídico.

VI. Gestionar a través de la UNIDAD EJECUTORA , a los cinco (5) días hábiles de la recepción de los recursos, los procesos de adquisición para la compra de los insumos que se determinan en el Anexo 5 y que son necesarios para dar cumplimiento a las actividades contenidas en este instrumento.

VII. Entregar, por conducto de la UNIDAD EJECUTORA , a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, en los términos estipulados en el presente Convenio Específico, los informes mensuales sobre el ejercicio, destino y los resultados obtenidos con los recursos transferidos en virtud del presente instrumento jurídico, así como sobre el avance financiero y estado de cuenta bancario, mediante el cual deberá identificar e informar los rendimientos financieros generados.

VIII. Mantener bajo su custodia, a través de la UNIDAD EJECUTORA , la documentación comprobatoria original de los recursos federales erogados, la cual deberá exhibir a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios y, en su caso, a la Secretaría de Hacienda y Crédito Público, así como por los órganos fiscalizadores competentes, cuando le sea requerida.

IX. Verificar que la documentación comprobatoria del gasto de los recursos federales objeto de este Convenio Específico, haya sido emitida por la persona física o moral a la que se efectuó el pago correspondiente y cumpla con los requisitos fiscales establecidos en las disposiciones federales aplicables, entre otros, aquéllos que determinan los artículos 29 y 29-A, del Código Fiscal de la Federación, los que deberán expedirse a nombre de LA ENTIDAD. Para lo cual, se deberá remitir archivo electrónico CFDI. Asimismo, deberá remitir a LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, el archivo electrónico con la Verificación de Comprobantes Fiscales Digitales por Internet, emitido por el Servicio de Administración Tributaria (SAT).

La autenticidad de la documentación justificatoria y comprobatoria de los recursos federales erogados, será responsabilidad de la UNIDAD EJECUTORA.

X. Es obligatorio cancelar, por conducto de la UNIDAD EJECUTORA , la documentación comprobatoria, con la leyenda Operado con recursos federales, para el ( Programa Institucional que corresponda) del Ejercicio Fiscal 2022.

XI. Reportar y dar seguimiento mensual, a través de la Comisionada Estatal para la Protección contra Riesgos Sanitarios, sobre el cumplimiento de los programas, proyectos, objetivos, indicadores y metas, previstos en el Anexo 2 de este Convenio Específico, los resultados de las evaluaciones que se hayan realizado.

XII. Reintegrar a la Tesorería de la Federación dentro de los quince (15) días naturales siguientes en que los requiera LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, los recursos presupuestarios federales transferidos y sus rendimientos financieros, que después de radicados a la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD, no hayan sido ministrados a la UNIDAD EJECUTORA, o que una vez ministrados a esta última, se mantengan ociosos o no sean ejercidos en los términos del presente Convenio Específico.

XIII. Mantener actualizada, la información relativa a los avances en el ejercicio de los resultados de los recursos transferidos, así como aportar los elementos que resulten necesarios para la evaluación de los resultados que se obtengan con los mismos.

XIV. Proporcionar, por conducto de la UNIDAD EJECUTORA , la información y documentación que LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, le solicite en las visitas de verificación que ésta última opte por realizar, para observar el cumplimiento de las obligaciones establecidas en el presente instrumento jurídico, así como que los recursos federales transferidos con motivo del mismo, sean destinados únicamente para el cumplimiento de su objeto.

XV. Establecer, con base en el seguimiento de los resultados de las evaluaciones realizadas, medidas de mejora continua para el cumplimiento de los objetivos para los que se destinen los recursos transferidos.

XVI. Informar sobre la suscripción de este Convenio Específico, a los órganos de control y de fiscalización de LA ENTIDAD y entregarles copia del mismo.

XVII. Difundir en la página de Internet de la UNIDAD EJECUTORA , el presente Convenio Específico, así como los conceptos financiados con los recursos federales transferidos en virtud del mismo, incluyendo los avances y resultados físicos y financieros, en los términos de las disposiciones aplicables.

XVIII. Gestionar, por conducto de la UNIDAD EJECUTORA, la publicación del presente instrumento jurídico en el órgano de difusión oficial de LA ENTIDAD.

OCTAVA. OBLIGACIONES DE LA SECRETARÍA.- Adicionalmente a los compromisos establecidos en EL ACUERDO MARCO, LA SECRETARÍA, a través de la Comisión Federal para la Protección contra Riesgos Sanitarios, se obliga a:

I. Transferir a LA ENTIDAD, con el carácter de subsidios, los recursos federales a que se refiere el presente Convenio Específico.

II. Verificar que los recursos federales que en virtud de este instrumento jurídico se transfieran, hayan sido aplicados conforme al objeto del mismo, sin perjuicio de las atribuciones que en la materia correspondan a otras instancias competentes de los poderes Ejecutivo y Legislativo Federales y/o de LA ENTIDAD.

III. Verificar que la UNIDAD EJECUTORA , envíe en los términos estipulados en el presente Convenio Específico, los informes mensuales sobre el ejercicio, y los resultados obtenidos con los recursos transferidos en virtud de la celebración del presente instrumento jurídico, así como sobre el avance financiero y estado de cuenta bancario, mediante el cual identifique e informe los rendimientos financieros.

IV. Verificar que LA ENTIDAD, por conducto de la UNIDAD EJECUTORA , envíe la documentación justificatoria y comprobatoria del gasto de los recursos federales transferidos, en términos de lo estipulado en el presente Convenio Específico.

V. Verificar que LA ENTIDAD efectúe, dentro de los quince (15) días naturales siguientes, el reintegro a la Tesorería de la Federación, de los recursos federales transferidos y sus rendimientos financieros, que después de radicados a la Secretaría de Planeación, Finanzas y Administración de LA ENTIDAD, no hayan sido ministrados a la UNIDAD EJECUTORA, o que una vez ministrados a esta última, se mantengan ociosos o no sean ejercidos en los términos del presente Convenio Específico.

VI. Presentar el Informe de la Cuenta de la Hacienda Pública Federal y los demás informes que sean requeridos, sobre la aplicación de los recursos transferidos con motivo del presente Convenio Específico.

VII. Dar seguimiento mensualmente, en coordinación con LA ENTIDAD, sobre el avance en el cumplimiento de la realización de las acciones objeto del presente instrumento jurídico.

VIII. Establecer medidas de mejora continua para el cumplimiento de los objetivos para los que se destinen los recursos financieros transferidos, con base en el seguimiento de los resultados de las evaluaciones realizadas.

IX. Informar sobre la suscripción de este Convenio Específico a la Auditoría Superior de la Federación.

X. Difundir en su página de Internet el presente Convenio Específico, así como los conceptos financiados con los recursos federales transferidos en virtud del mismo, incluyendo los avances y resultados físicos y financieros, en los términos de las disposiciones aplicables.

XI. Realizar las gestiones necesarias para la publicación del presente instrumento jurídico en el Diario Oficial de la Federación.

NOVENA. ACCIONES DE VERIFICACIÓN, SEGUIMIENTO, EVALUACIÓN Y CONTROL.- La verificación, seguimiento y evaluación de los recursos presupuestarios federales transferidos por LA SECRETARÍA a LA ENTIDAD con motivo del presente instrumento jurídico, corresponderá a LA SECRETARÍA y a la Secretaría de Hacienda y Crédito Público, en los términos de las disposiciones aplicables y estipulaciones del presente Convenio Específico.

Para el caso de LA SECRETARÍA, las acciones a que se refiere el párrafo anterior, se realizarán por conducto de la Comisión Federal para la Protección contra Riesgos Sanitarios, a través de las unidades administrativas que la integran, conforme a las atribuciones que les confiere el Reglamento de la Comisión Federal para la Protección contra Riesgos Sanitarios, quienes estarán obligadas a dar seguimiento al cumplimiento del objeto del presente instrumento jurídico, así como a los objetivos, actividades específicas, indicadores y metas que se precisan en su Anexo 4.

El control y la fiscalización de dichos recursos, quedarán a cargo de las autoridades federales y locales, en sus respectivos ámbitos de competencia, de conformidad con las disposiciones jurídicas aplicables.

Cuando las autoridades federales o locales que participen en la ejecución del presente Convenio Específico, detecten que los recursos presupuestarios federales transferidos no han sido aplicados a los fines que se señalan en el presente Convenio Específico, deberán hacerlo del conocimiento, en forma inmediata, de la Auditoría Superior de la Federación y de la Secretaría de la Función Pública y, en su caso, del Ministerio Público de la Federación.

En el caso de que LA ENTIDAD incumpla con cualquiera de las obligaciones contraídas en el presente instrumento jurídico y/o aquellas legalmente establecidas, se dará aviso a los Órganos Fiscalizadores competentes, para su intervención y se solicitará el reintegro, a la Tesorería de la Federación, de recursos transferidos no devengados ni comprobados, así como los rendimientos financieros generados.

DÉCIMA. MANEJO DE LA INFORMACIÓN.- El manejo de la información que se presente, obtenga o produzca en virtud del cumplimiento de este instrumento jurídico, será clasificada por LAS PARTES, atendiendo a los principios de confidencialidad, reserva y protección de datos personales que se desprenden de las disposiciones aplicables en la materia, por lo que LAS PARTES, se obligan a utilizarla o aprovecharla únicamente para el cumplimiento del objetivo del presente Convenio Específico.

Asimismo, LAS PARTES se obligan a no revelar, copiar, reproducir, explotar, comercializar, modificar, duplicar, divulgar o difundir a terceros, la información que tenga carácter de confidencial, sin la autorización previa y por escrito del titular de la misma y de LAS PARTES.

DÉCIMA PRIMERA. AVISOS, COMUNICACIONES Y NOTIFICACIONES.- LAS PARTES convienen en que todos los avisos, comunicaciones y notificaciones que se realicen con motivo del presente instrumento jurídico, se llevarán a cabo por escrito en los domicilios señalados en el apartado de Declaraciones.

Cualquier cambio de domicilio de LAS PARTES deberá ser notificado por escrito a la otra, con al menos diez (10) días naturales de anticipación a la fecha en que se pretenda que surta efectos ese cambio. Sin este aviso, todas las comunicaciones se entenderán válidamente hechas en los domicilios señalados por LAS PARTES.

DÉCIMA SEGUNDA. RELACIÓN LABORAL.- Queda expresamente estipulado por LAS PARTES, que el personal contratado, empleado o comisionado por cada una de ellas para dar cumplimiento al presente instrumento jurídico, guardará relación laboral únicamente con aquélla que lo contrató, empleó o comisionó, por lo que asumen plena responsabilidad por este concepto, sin que en ningún caso, la otra parte pueda ser considerada como patrón sustituto o solidario, obligándose en consecuencia, cada una de ellas, a sacar a la otra, en paz y a salvo, frente a cualquier reclamación, demanda o sanción, que su personal pretendiese fincar o entablar en su contra, deslindándose desde ahora de cualquier responsabilidad de carácter laboral, civil, penal, administrativa o de cualquier otra naturaleza jurídica que en ese sentido se les quiera fincar.

DÉCIMA TERCERA. VIGENCIA.- El presente Convenio Específico comenzará a surtir sus efectos a partir de la fecha de su suscripción y se mantendrá en vigor hasta el 31 de diciembre de 2022.

La conclusión de la vigencia del presente instrumento jurídico no exime las obligaciones de comprobación, envío de documentación (estados de cuenta bancarios, notificación del cierre de la cuenta bancaria aperturada para el ejercicio fiscal, cierre del ejercicio) y/o reintegro a cargo de LA ENTIDAD.

DÉCIMA CUARTA. MODIFICACIONES AL CONVENIO ESPECÍFICO.- LAS PARTES acuerdan que el presente Convenio Específico podrá modificarse de común acuerdo por escrito, sin alterar su estructura y en estricto apego a las disposiciones jurídicas aplicables. Las modificaciones al Convenio Específico obligarán a sus signatarios a partir de la fecha de su firma y deberán publicarse en el Diario Oficial de la Federación y en el órgano de difusión oficial de LA ENTIDAD.

En circunstancias especiales, caso fortuito o de fuerza mayor, para la realización del objeto previsto en este instrumento jurídico, LAS PARTES acuerdan tomar las medidas o mecanismos que permitan afrontar dichas eventualidades. En todo caso, las medidas y mecanismos acordados serán formalizados mediante la suscripción del Convenio Modificatorio correspondiente.

DÉCIMA QUINTA. CAUSAS DE TERMINACIÓN.- El presente Convenio Específico podrá darse por terminado de manera anticipada en los supuestos estipulados en EL ACUERDO MARCO.

DÉCIMA SEXTA. CAUSAS DE RESCISIÓN.- El presente Convenio Específico podrá rescindirse por las causas que señala EL ACUERDO MARCO.

DÉCIMA SÉPTIMA. INTERPRETACIÓN, JURISDICCIÓN Y COMPETENCIA.- LAS PARTES manifiestan su conformidad para interpretar y resolver, de común acuerdo, todo lo relativo a la ejecución y cumplimiento del presente Convenio Específico, así como en sujetar todo lo no previsto en el mismo a lo dispuesto en las disposiciones jurídicas aplicables .

Asimismo, convienen en que de las controversias que surjan con motivo de la ejecución y cumplimiento del presente Convenio Específico, conocerán los tribunales federales competentes en la Ciudad de México, renunciando LAS PARTES a cualquier otra jurisdicción que pudiera corresponderles en razón de su domicilio presente o futuro.

Enteradas las partes del contenido y alcance legal del presente Convenio Específico, lo firman por quintuplicado a los quince días del mes de junio de dos mil veintidós.- Por la Secretaría: el Comisionado Federal para la Protección contra Riesgos Sanitarios, Dr. Alejandro Ernesto Svarch Pérez .- Rúbrica.- La Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, C. Anahi Guadalupe Orozco .- Rúbrica.- Por la Entidad: la Secretaria de Planeación, Finanzas y Administración, C. Fabiola Verduzco Aparicio .- Rúbrica.- La Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, Dra. Martha Janeth Espinosa Mejía .- Rúbrica.- La Comisionada Estatal para la Protección contra Riesgos, Dra. Tania Irerí Ríos Cuevas .- Rúbrica.

ANEXO 1

CONCEPTOS PARA LA APLICACIÓN DE RECURSOS

ENTIDAD:

COLIMA

CONCEPTO:

Fortalecimiento de la ejecución y desarrollo del Programa y Proyectos Federales de Protección contra Riesgos Sanitarios (Regulación y Fomento Sanitarios) y Fortalecimiento de la Red Nacional de Laboratorios (Laboratorio Estatal de Salud Pública)

PROGRAMA:

Protección contra Riesgos Sanitarios

CONVENIO CLAVE:

COFEPRIS-CETR-COL.-07-22

Programa

Objetivo específico

Protección contra riesgos sanitarios

Fortalecimiento a la Red Nacional de Laboratorios

Total

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Mantener las acciones de control sanitario que garanticen la inocuidad de los alimentos incluso durante las emergencias sanitarias (COVID-19).

$1,398,231.00

$948,508.00

$2,346,739.00

Establecer un Sistema de Alerta Temprana de Florecimientos de Algas Nocivas (Marea Roja), con el fin de aplicar medidas preventivas de manera oportuna, tendientes a evitar el consumo de moluscos bivalvos expuestos a mareas rojas tóxicas.

$335,248.00

$188,066.00

$523,314.00

Proteger a la población de riesgos potencialmente presentes en el agua de uso y consumo humano (incluye agua de consumo, para la preparación de alimentos e higiene, así como para actividades recreativas en agua).

$1,013,922.00

$719,557.00

$1,733,479.00

Incrementar el número de notificaciones de RAMs recibidas por las entidades federativas. Utilizar a la Farmacovigilancia como herramienta que permita conocer el perfil de seguridad de los medicamentos.

Fomentar actividades de Farmacovigilancia mediante la capacitación constante.

$294,364.00

$294,364.00

Disminuir riesgos sanitarios a través de la vigilancia basada en riesgos.

$621,436.00

$188,066.00

$809,502.00

Incrementar el conocimiento de las medidas preventivas de protección a la salud relacionadas al saneamiento básico.

$81,768.00

$81,768.00

Implementar mecanismos de coordinación en materia de difusión, capacitación, supervisión y vinculación, orientados a fortalecer la rendición de cuentas, promover la integridad en el servicio público, prevenir actos discrecionales y/o de corrupción y dar certeza sobre la correcta ejecución de los procesos de regulación, control y fomento sanitario.

$204,420.00

$204,420.00

Desarrollar, implementar y/o fortalecer los Sistemas de Gestión de la Calidad en el Sistema Federal Sanitario con base en la Norma ISO 9001:2015.

$122,652.00

$122,652.00

Dar atención oportuna, organizada y sistemática a los eventos de emergencias sanitarias en materia de desastres naturales, brotes por enfermedades infecciosas y/o emergentes, eventos de concentración masiva, infecciones asociadas a la atención de la salud, bioterrorismo y/o exposición a otros agentes, a través de acciones de control sanitario.

$834,033.00

$834,033.00

Mantener las acciones de control sanitario que garanticen la certificación y condición sanitaria de los sistemas de abastecimiento de agua públicos y privados de conformidad con la NOM-179-SSA1-2020, Agua para uso y consumo humano. Control de la calidad del agua distribuida por los sistemas de abastecimiento de agua. Las descargas de aguas residuales. Las características sanitarias y los criterios que deban cumplir los usuarios que aprovechen en su servicio aguas que posteriormente sean descargadas a cuerpos de agua destinadas al uso y consumo humano, el manejo adecuado de sustancias toxicas y residuos tóxicos, la protección y seguimiento a la salud de su personal ocupacionalmente expuesto.

Fortalecimiento de la capacidad analítica conforme a los requerimientos establecidos, por la Comisión de Evidencia y Manejo de Riesgos (CEMAR) y Comisión de Operación Sanitaria (COS) responsables de los programas de vigilancia sanitaria; así como sistemas de gestión de calidad para el mantenimiento de la Autorización como Tercero Autorizado (TA).

$1,226,518.00

$1,226,518.00

TOTAL

$4,906,074.00

$3,270,715.00

$8,176,789.00

LOS SERVIDORES PÚBLICOS QUE INTERVIENEN EN LA ELABORACIÓN, SUSCRIPCIÓN Y RECEPCIÓN DE LOS RECURSOS OTORGADOS A TRAVÉS DEL PRESENTE CONVENIO DE COLABORACIÓN ENTRE LA COFEPRIS Y EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, DEBERÁN DAR CUMPLIMIENTO A LO ESTABLECIDO EN LA LEY FEDERAL DE AUSTERIDAD REPUBLICANA, SUS LINEAMIENTOS Y NORMAS ESPECÍFICAS DICTADAS SOBRE LA MATERIA POR LAS AUTORIDADES RESPONSABLES.

ANEXO 1 DEL CONVENIO ESPECÍFICO EN MATERIA DE TRANSFERENCIA DE RECURSOS FEDERALES CON EL CARÁCTER DE SUBSIDIOS, PARA FORTALECER LA EJECUCIÓN Y DESARROLLO DEL PROGRAMA Y PROYECTOS DE PROTECCIÓN CONTRA RIESGOS SANITARIOS, ASÍ COMO LA RED NACIONAL DE LABORATORIOS, QUE CELEBRAN POR UNA PARTE EL EJECUTIVO FEDERAL, POR CONDUCTO DE LA SECRETARÍA DE SALUD, A TRAVÉS DE LA COMISIÓN FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, Y POR LA OTRA, EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, EL QUINCE DE JUNIO DEL AÑO DOS MIL VEINTIDOS.

Por la Secretaría: el Comisionado Federal para la Protección contra Riesgos Sanitarios, Dr. Alejandro Ernesto Svarch Pérez .- Rúbrica.- La Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, C. Anahi Guadalupe Orozco .- Rúbrica.- Por la Entidad: la Secretaria de Planeación, Finanzas y Administración, C. Fabiola Verduzco Aparicio .- Rúbrica.- La Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, Dra. Martha Janeth Espinosa Mejía .- Rúbrica.- La Comisionada Estatal para la Protección contra Riesgos Sanitarios, Dra. Tania Irerí Ríos Cuevas .- Rúbrica.

ANEXO 2

PROGRAMAS, OBJETIVOS, INDICADORES Y METAS

ENTIDAD:

COLIMA

CONCEPTO:

Fortalecimiento de la ejecución y desarrollo del Programa y Proyectos Federales de Protección contra Riesgos Sanitarios (Regulación y Fomento Sanitarios) y Fortalecimiento de la Red Nacional de Laboratorios (Laboratorio Estatal de Salud Pública)

PROGRAMA:

Protección contra Riesgos Sanitarios

CONVENIO CLAVE:

COFEPRIS-CETR-COL.-07-22

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Mantener las acciones de control sanitario que garanticen la inocuidad de los alimentos incluso durante las emergencias sanitarias (COVID-19).

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

1. Enviar a la COFEPRIS el padrón de establecimientos que empacan productos agrícolas frescos o mínimamente procesados en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

1

1

2. Realizar visitas de verificación a los establecimientos que procesan los productos agrícolas frescos y mínimamente procesados (hortalizas y/o frutas) (APCRS).

2

1

1

1

1

6

3. Realizar la toma de muestras y envío de las mismas al LESP de los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a las cuales se efectuarán las determinaciones especificadas en la programación correspondiente y que deben coincidir con las registradas en el apartado del LESP (APCRS).

114

113

113

113

113

566

4. Notificar los resultados de análisis los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a la COFEPRIS de manera mensual en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

1

1

1

1

1

5

5. Cumplir con el número de visitas programadas para la toma de muestras de agua y producto en las áreas de cosecha de moluscos bivalvos, así como el envío de muestras a los LESP (APCRS).

6. Notificar los resultados de análisis de las determinaciones realizadas en agua y producto a la COFEPRIS de manera mensual a través del sistema electrónico autorizado en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

7. Elaborar, promover y coordinar un programa de capacitación en materia de inocuidad de los alimentos dirigida a los manejadores de alimentos.

20%

40%

40%

100%

8. Coordinar estrategias de difusión, dirigidas a manejadores de alimentos y a la población en general, con el propósito de contribuir a la disminución de los riesgos sanitarios asociados con el consumo de alimentos, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

20%

40%

40%

100%

LESP

9. Realizar las determinaciones especificadas en las sábanas de muestreo a los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), de conformidad con lo establecido en los lineamientos emitidos para este fin (LESP).

114

113

113

113

113

566

10. Realizar el análisis del número de determinaciones establecidas para agua (coliformes fecales) en áreas de cosecha de moluscos bivalvos (LESP).

11. Realizar el análisis del número de determinaciones establecidas para producto (E. coli, Salmonella sp, Vibrio cholerae y Vibrio parahaemolyticus) en áreas de cosecha de moluscos bivalvos (LESP).

12. Realizar análisis de biotoxinas marinas en moluscos bivalvos de acuerdo con lo establecido por COFEPRIS (pruebas para detección de PSP, ASP y DSP en los Estados con litoral en el Océano Pacífico y PSP, ASP, DSP y NSP en los Estado del Golfo de México) de acuerdo con los criterios técnicos establecidos por COFEPRIS (LESP).

3

3

3

3

3

3

18

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Establecer un Sistema de Alerta Temprana de Florecimientos de Algas Nocivas (Marea Roja), con el fin de aplicar medidas preventivas de manera oportuna, tendientes a evitar el consumo de moluscos bivalvos expuestos a mareas rojas tóxicas.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

13. Realizar el monitoreo de fitoplancton en agua de mar, con base en los lineamientos emitidos por la COFEPRIS (APCRS).

12

12

12

12

12

12

72

14. Notificar los resultados de análisis de agua de mar a la COFEPRIS de manera mensual a través del sistema electrónico autorizado en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

1

1

1

1

1

5

LESP

15. Realizar las determinaciones al agua de mar con base en los lineamientos emitidos por la COFEPRIS (LESP).

12

12

12

12

12

12

72

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Proteger a la población de riesgos potencialmente presentes en el agua de uso y consumo humano (Incluye agua de consumo, para la preparación de alimentos e higiene, así como para actividades recreativas en agua).

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

16. Enviar a la COFEPRIS programa de trabajo de vigilancia de la calidad del agua de la red de distribución de agua, incluyendo posibles riesgos identificados previamente, de acuerdo a los lineamientos técnicos emitidos por la COFEPRIS.

1

1

17. Enviar a la COFEPRIS informe mensual sobre los resultados del monitoreo de cloro residual realizado en la entidad federativa.

1

1

1

1

1

1

1

7

18. Enviar a la COFEPRIS informe mensual sobre las notificaciones realizadas a los responsables del abastecimiento del agua en localidades, municipios o entidades federativas, respecto a los resultados de los hallazgos obtenidos durante el monitoreo, así como de las acciones realizadas.

1

1

1

1

1

1

1

7

19. Enviar a la COFEPRIS reporte mensual sobre resultados de análisis bacteriológicos realizados conforme a los lineamientos establecidos, de acuerdo con la meta establecida entre la COFEPRIS y la entidad federativa.

1

1

1

1

1

1

1

7

20. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de Flúor, Arsénico, Plomo, Plaguicidas y/u otros analitos de riesgo en agua de uso y consumo humano priorizados por la entidad federativa.

1

1

1

1

1

1

1

7

21. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de playas prioritarias de acuerdo a lo establecido en los lineamientos establecidos por la COFEPRIS.

1

1

2

22. Enviar a la COFEPRIS informe mensual sobre la asistencia a las reuniones convocadas por los Comités de Playas, incluyendo información sobre los acuerdos generados durante dichas reuniones o las minutas correspondientes, en caso de que no se realicen se deberá informar en ese sentido.

1

1

1

1

1

1

1

7

23. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de E. coli realizados en cuerpos de agua dulce para uso recreativo con contacto primario.

24. Implementar acciones de capacitación con el objetivo de disminuir riesgos asociados por el uso y consumo de agua, de acuerdo a los lineamientos emitidos por la COFEPRIS.

20%

40%

40%

100%

25. Coordinar estrategias de difusión con el objetivo de disminuir los riesgos asociados al uso y consumo de agua, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

20%

40%

40%

100%

LESP

26. Realizar los análisis bacteriológicos conforme a la meta y lineamientos establecidos.

100%

100%

100%

100%

100%

100%

100%

100%

27. Realizar los análisis de Flúor, Arsénico, Plomo, Plaguicidas y/u otros analitos de riesgo en agua de uso y consumo humano conforme a la meta y lineamientos establecidos.

7

8

8

8

8

8

8

55

28. Realizar los análisis del monitoreo de playas prioritarias conforme a la meta y lineamientos establecidos.

174

174

348

29. Realizar los análisis de E. coli en cuerpos de agua dulce para uso recreativo con contacto primario conforme a la meta y lineamientos establecidos.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Incrementar el número de notificaciones de RAMs recibidas por las entidades federativas. Utilizar a la Farmacovigilancia como herramienta que permita conocer el perfil de seguridad de los medicamentos. Fomentar actividades de Farmacovigilancia mediante la capacitación constante.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

30. Elaborar el plan de trabajo anual.

1

1

31. Implementación y seguimientos de unidades del sistema nacional de salud.

1

1

1

3

32. Elaborar el reporte mensual.

1

1

1

1

1

1

6

33. Realizar capacitaciones en materia de Farmacovigilancia.

1

1

2

34. Realizar asesorías en Farmacovigilancia.

1

1

1

1

1

1

1

7

35. Congreso Estatal de Farmacovigilancia.

1

1

36. Acudir a la reunión nacional.

1

1

37. Elaborar reporte final de actividades.

1

1

38. Coordinar estrategias de difusión en el tema de farmacovigilancia dirigidas al personal de salud y a la población en general, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

20%

40%

40%

100%

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Disminuir riesgos sanitarios a través de la vigilancia basada en riesgos.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

39. Implementar el Programa de Vigilancia Sanitaria en materia de productos y servicios, basado en riesgos así como: Realizar visitas de verificación sanitaria en materia de productos y servicios, para conocer las condiciones sanitarias de los establecimientos y productos relacionados, a fin de proteger a la población de riesgos sanitarios.

30

30

30

30

30

30

30

210

40. Realizar visitas de verificación sanitaria en establecimientos dedicados a la fabricación, venta y distribución de SUPLEMENTOS ALIMENTICIOS (PRODUCTOS ENGAÑO) para conocer las condiciones sanitarias de los establecimientos y productos relacionados, a fin de proteger a la población de riesgos sanitarios.

3

3

3

3

3

3

3

21

41. Realizar visitas de verificación sanitaria para vigilar el cumplimiento de la modificación de la NOM-051-SCFI/SSA1-2010, para conocer el cumplimento de los productos relacionados, a fin de proteger a la población de riesgos sanitarios.

3

3

3

3

3

3

3

21

42. Realizar visitas de verificación sanitaria en establecimientos dedicados al sacrificio y faenado de productos cárnicos (RASTROS y MATADEROS), para constatar las condiciones sanitarias en las que operan los establecimientos, a fin de proteger a la población de riesgos sanitarios.

2

2

2

2

2

1

1

12

43. Realizar el muestreo de los productos cárnicos para determinación de Clenbuterol en Rastros, Mataderos y Puntos de venta, durante la verificación sanitaria de conformidad con lo establecido en los lineamientos emitidos para este fin.

4

5

5

4

4

4

4

30

44. Realizar visitas de verificación sanitarias en establecimientos de los Sistemas Estatales DIF (comedores, asilos, guarderías, alberges, centros de atención múltiples y de rehabilitación, centros asistenciales de desarrollo infantil entre otros) con el objetivo de conocer las acciones y medidas establecidas para asegurar la calidad e inocuidad alimentaria, a fin de proteger a la población de riesgos sanitarios.

2

2

2

2

8

45. Realizar visitas de verificación sanitaria en materia de Establecimientos Especializados en la Atención de las Adicciones, por Saneamiento Básico y por Atención Medica Ambulatoria.

1

1

1

1

4

46. Realizar las visitas de verificación a los establecimientos del Sector Salud que realizan estudios de mastografía.

1

1

1

1

4

47. Atender las solicitudes de evaluación de condiciones sanitarias de los bienes asegurados en los almacenes (fiscalizados o no) del Instituto para Devolver al Pueblo lo Robado, la Fiscalía General de la República y el Sistema de Administración Tributaria que garanticen la inocuidad de los bienes asegurados, que sean susceptibles de entregar en Donación.

1

1

2

LESP

48. Realizar el análisis de los productos cárnicos para determinación de Clenbuterol en Rastros, Mataderos y Puntos de venta de conformidad con lo establecido en los lineamientos emitidos para este fin.

4

5

5

4

4

4

4

30

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Incrementar el conocimiento de las medidas preventivas de protección a la salud relacionadas al saneamiento básico.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

49. Desarrollar la metodología de comunicación de riesgos en temas de saneamiento, en al menos una comunidad, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

20%

40%

40%

100%

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Implementar mecanismos de coordinación en materia de difusión, capacitación, supervisión y vinculación, orientados a fortalecer la rendición de cuentas, promover la integridad en el servicio público, prevenir actos discrecionales y/o de corrupción y dar certeza sobre la correcta ejecución de los procesos de regulación, control y fomento sanitario.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

50. Suscribir la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

1

1

51. Difundir la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario en los medios estatales.

1

1

52. Establecer campañas de difusión en los medios estatales para que el sector regulado conozca los mecanismos implementados por el APCRS derivados de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

1

1

1

1

1

1

6

53. Formalizar instrumentos de colaboración en materia de prevención de la corrupción, con cámaras y prestadores de servicios que se encuentren dentro del ámbito de competencia de la COFEPRIS y las APCRS.

1

1

1

3

54. Elaborar un apartado específico de difusión institucional dentro de los sitios web oficiales de las APCRS, destinado a dar a conocer la implementación de las acciones específicas de la Estrategia Nacional.

1

1

1

1

1

5

55. Participar en el programa de capacitación nacional sobre procesos de autorización, verificación y vinculación con los sectores público, privado y social.

1

1

56. Promover la participación en la supervisión de los procesos de autorización, verificación y vinculación con el sector público, privado y social que realizará la COFEPRIS.

1

1

57. Instalar y poner en funcionamiento cámaras de videograbación de solapa durante verificaciones sanitarias.

1

1

1

1

4

58. Instalar y poner en funcionamiento salas multidisciplinarias que cuenten con cámaras de videograbación para brindar atención al sector regulado.

1

1

1

1

4

59. Establecer un centro de monitoreo para la evaluación y análisis de las videograbaciones resultantes de las verificaciones sanitarias y de la atención al sector regulado.

1

1

1

1

4

60. Capacitar a las personas servidoras públicas en materia de prevención de actos de corrupción, así como fomentar la integridad en el ejercicio de sus funciones.

1

1

2

61. Promover un área específica de vinculación para turnar conocimiento a las instancias correspondientes en temas relacionados con presuntos actos de corrupción.

1

1

1

1

1

1

6

62. Enviar mensualmente los avances de la ejecución de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

1

1

1

1

1

1

1

7

63. Elaborar el informe final de la implementación de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario en donde se describa el impacto de las acciones emprendidas.

1

1

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Desarrollar, implementar y/o fortalecer los Sistemas de Gestión de la Calidad en el Sistema Federal Sanitario con base en la Norma ISO 9001:2015.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

64. Designar un enlace o responsable del SGC y su equipo de trabajo.

1

1

65. Constituir un Comité de la Calidad y establecer su procedimiento de funcionamiento.

1

1

2

66. Capacitar en los temas del SGC.

1

1

1

1

1

1

6

67. Conocer la organización y contexto (análisis FODA).

1

1

68. Crear, someter a autorización y difundir la Filosofía de la Calidad: Misión, Visión, Política de la Calidad y Objetivos de la Calidad.

1

1

69. Crear, someter a autorización y difundir el mapa y diagrama de procesos.

1

1

2

70. Determinar el alcance del SGC.

1

1

71. Describir las partes interesadas del SGC.

1

1

72. Determinar roles, responsabilidades y autoridades en el APCRS para el SGC.

1

1

73. Determinar los riesgos y oportunidades de los procesos establecidos en el SGC.

1

1

74. Crear, actualizar y controlar la información documentada del APCRS con base en los lineamientos de la Norma ISO 9001:2015.

1

1

2

75. Implementar actividades de seguimiento y medición de cumplimiento de objetivos.

1

1

76. Capacitar a auditores internos de calidad.

77. Generar evidencia de las revisiones del titular de la APCRS respecto al desarrollo, implementación, mantenimiento y/o fortalecimiento del Sistema de Gestión de la Calidad.

1

1

78. Gestionar con un organismo certificador acreditado por la Entidad Mexicana de Acreditación (EMA) la Auditoría externa de certificación, recertificación o mantenimiento del Sistema de Gestión de Calidad (para aquéllas APCRS que se encuentran en este proceso).

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Dar atención oportuna, organizada y sistemática a los eventos de emergencias sanitarias en materia de desastres naturales, brotes por enfermedades infecciosas y/o emergentes, eventos de concentración masiva, infecciones asociadas a la atención de la salud, bioterrorismo y/o exposición a otros agentes, a través de acciones de control sanitario.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

79. Notificar los eventos de emergencias sanitarias en un plazo no mayor a 24 horas, del conocimiento de ocurrencia e independientemente de la magnitud.

100%

100%

100%

100%

100%

100%

100%

100%

80. Contar con la evidencia del personal, desde nivel Jurisdiccional al Estatal (padrón de brigadistas), que fue capacitado en materia de emergencias sanitarias.

1

1

81. Remitir la evidencia de la adquisición de los insumos y materiales requeridos para la atención de emergencias sanitarias, incluyendo equipos de protección personal para el seguro desempeño de las funciones.

1

1

82. Enviar informe mensual y anual de atención a eventos de emergencias sanitarias.

1

1

1

1

1

1

2

8

83. Desarrollar y promover estrategias de difusión, con el fin de informar a la población en general, los riesgos a los que están expuestos y como evitarlos en circunstancias de emergencias sanitarias.

20%

40%

40%

100%

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Mantener las acciones de control sanitario que garanticen la certificación y condición sanitaria de los sistemas de abastecimiento de agua públicos y privados de conformidad con la NOM-179-SSA1-2020, Agua para uso y consumo humano. Control de la calidad del agua distribuida por los sistemas de abastecimiento de agua. Las descargas de aguas residuales. Las características sanitarias y los criterios que deban cumplir los usuarios que aprovechen en su servicio aguas que posteriormente sean descargadas a cuerpos de agua destinadas al uso y consumo humano, el manejo adecuado de sustancias toxicas y residuos tóxicos, la protección y seguimiento a la salud de su personal ocupacionalmente expuesto.

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

APCRS

84. Enviar a la COFEPRIS el Padrón de Sistemas de Abastecimiento de Agua Públicos y Privados en el Estado.

85. Reportar mensualmente la certificación de sistemas de abastecimiento de agua para uso y consumo humano, públicos y privados, en municipios señalados en las RESAs (Anexo RESAs).

86. Realizar visitas de verificación a los sistemas de abastecimiento de agua para uso y consumo humano, públicos y privados, en municipios señalados en las RESAs (Anexo RESAs).

87. Realizar las acciones de fomento que correspondan con los Operadores de los sistemas de abastecimiento de agua públicos y privados, en los municipios que se han identificado en las RESAs. (Anexo RESAs).

88. Realizar visitas de verificación a empresas que residan dentro los municipios que conforman las Regiones de Emergencia Sanitaria y Ambiental (Anexo RESAs).

89. Realizar visitas de fomento a micro y pequeñas empresas que residan dentro los municipios que conforman las Regiones de Emergencia Sanitaria y Ambiental (Anexo RESAs).

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Fortalecimiento de la capacidad analítica conforme a los requerimientos establecidos, por la Comisión de Evidencia y Manejo de Riesgos (CEMAR) y Comisión de Operación Sanitaria (COS) responsables de los programas de vigilancia sanitaria; así como sistemas de gestión de calidad para el mantenimiento de la Autorización como Tercero Autorizado (TA).

Actividad Específica

Metas

Jun

Jul

Ags

Sept

Oct

Nov

Dic

TOTAL

LESP

90. Realizar el análisis de las determinaciones establecidas en los objetivos específicos del presente convenio, acorde al binomio matriz-analito, conforme a lo establecido en los lineamientos técnicos.

1

1

1

1

1

1

1

7

91. Ampliar la autorización de métodos de prueba, acorde a la capacidad instalada en cada LESP y conforme a lo establecido en los lineamientos técnicos.

1

1

2

92. Mantener vigente la Autorización como Laboratorio de Prueba Tercero Autorizado.

1

1

2

93. Cumplir con las actividades relacionadas con el fortalecimiento técnico, competencia técnica, el envío de informes de atención de muestras como Laboratorio de Prueba de Tercero Autorizado y el aprovechamiento de recursos, acorde a lo establecido en los lineamientos técnicos.

1

1

1

1

1

1

1

7

LOS SERVIDORES PÚBLICOS QUE INTERVIENEN EN LA ELABORACIÓN, SUSCRIPCIÓN Y RECEPCIÓN DE LOS RECURSOS OTORGADOS A TRAVÉS DEL PRESENTE CONVENIO DE COLABORACIÓN ENTRE LA COFEPRIS Y EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, DEBERÁN DAR CUMPLIMIENTO A LO ESTABLECIDO EN LA LEY FEDERAL DE AUSTERIDAD REPUBLICANA, SUS LINEAMIENTOS Y NORMAS ESPECÍFICAS DICTADAS SOBRE LA MATERIA POR LAS AUTORIDADES RESPONSABLES.

ANEXO 2 DEL CONVENIO ESPECÍFICO EN MATERIA DE TRANSFERENCIA DE RECURSOS FEDERALES CON EL CARÁCTER DE SUBSIDIOS, PARA FORTALECER LA EJECUCIÓN Y DESARROLLO DEL PROGRAMA Y PROYECTOS DE PROTECCIÓN CONTRA RIESGOS SANITARIOS, ASÍ COMO LA RED NACIONAL DE LABORATORIOS, QUE CELEBRAN POR UNA PARTE EL EJECUTIVO FEDERAL, POR CONDUCTO DE LA SECRETARÍA DE SALUD, A TRAVÉS DE LA COMISIÓN FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, Y POR LA OTRA, EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, EL QUINCE DE JUNIO DEL AÑO DOS MIL VEINTIDOS.

Por la Secretaría: el Comisionado Federal para la Protección contra Riesgos Sanitarios, Dr. Alejandro Ernesto Svarch Pérez .- Rúbrica.- La Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, C. Anahi Guadalupe Orozco .- Rúbrica.- Por la Entidad: la Secretaria de Planeación, Finanzas y Administración, C. Fabiola Verduzco Aparicio .- Rúbrica.- La Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, Dra. Martha Janeth Espinosa Mejía .- Rúbrica.- La Comisionada Estatal para la Protección contra Riesgos Sanitarios, Dra. Tania Irerí Ríos Cuevas .- Rúbrica.

ANEXO 3

AVANCE FÍSICO-FINANCIERO 2022

ENTIDAD:

COLIMA

CONCEPTO:

Fortalecimiento de la ejecución y desarrollo del Programa y Proyectos Federales de Protección contra Riesgos Sanitarios (Regulación y Fomento Sanitarios) y Fortalecimiento de la Red Nacional de Laboratorios (Laboratorio Estatal de Salud Pública)

PROGRAMA:

Protección contra Riesgos Sanitarios

CONVENIO CLAVE:

COFEPRIS-CETR-COL.-07-22

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Mantener las acciones de control sanitario que garanticen la inocuidad de los alimentos incluso durante las emergencias sanitarias (COVID-19).

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

1. Enviar a la COFEPRIS el padrón de establecimientos que empacan productos agrícolas frescos o mínimamente procesados en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

2. Realizar visitas de verificación a los establecimientos que procesan los productos agrícolas frescos y mínimamente procesados (hortalizas y/o frutas) (APCRS).

3. Realizar la toma de muestras y envío de las mismas al LESP de los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a las cuales se efectuarán las determinaciones especificadas en la programación correspondiente y que deben coincidir con las registradas en el apartado del LESP (APCRS).

4. Notificar los resultados de análisis los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a la COFEPRIS de manera mensual en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

5. Cumplir con el número de visitas programadas para la toma de muestras de agua y producto en las áreas de cosecha de moluscos bivalvos, así como el envío de muestras a los LESP (APCRS).

6. Notificar los resultados de análisis de las determinaciones realizadas en agua y producto a la COFEPRIS de manera mensual a través del sistema electrónico autorizado en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

7. Elaborar, promover y coordinar un programa de capacitación en materia de inocuidad de los alimentos dirigida a los manejadores de alimentos.

8. Coordinar estrategias de difusión, dirigidas a manejadores de alimentos y a la población en general, con el propósito de contribuir a la disminución de los riesgos sanitarios asociados con el consumo de alimentos, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

LESP

9. Realizar las determinaciones especificadas en las sábanas de muestreo a los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), de conformidad con lo establecido en los lineamientos emitidos para este fin (LESP).

10. Realizar el análisis del número de determinaciones establecidas para agua (coliformes fecales) en áreas de cosecha de moluscos bivalvos (LESP).

11. Realizar el análisis del número de determinaciones establecidas para producto (E. coli, Salmonella sp, Vibrio cholerae y Vibrio parahaemolyticus) en áreas de cosecha de moluscos bivalvos (LESP).

12. Realizar análisis de biotoxinas marinas en moluscos bivalvos de acuerdo con lo establecido por COFEPRIS (pruebas para detección de PSP, ASP y DSP en los Estados con litoral en el Océano Pacífico y PSP, ASP, DSP y NSP en los Estado del Golfo de México) de acuerdo con los criterios técnicos establecidos por COFEPRIS (LESP).

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Establecer un Sistema de Alerta Temprana de Florecimientos de Algas Nocivas (Marea Roja), con el fin de aplicar medidas preventivas de manera oportuna, tendientes a evitar el consumo de moluscos bivalvos expuestos a mareas rojas tóxicas.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

13. Realizar el monitoreo de fitoplancton en agua de mar, con base en los lineamientos emitidos por la COFEPRIS (APCRS).

14. Notificar los resultados de análisis de agua de mar a la COFEPRIS de manera mensual a través del sistema electrónico autorizado en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

LESP

15. Realizar las determinaciones al agua de mar con base en los lineamientos emitidos por la COFEPRIS (LESP).

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Proteger a la población de riesgos potencialmente presentes en el agua de uso y consumo humano (Incluye agua de consumo, para la preparación de alimentos e higiene, así como para actividades recreativas en agua).

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

16. Enviar a la COFEPRIS programa de trabajo de vigilancia de la calidad del agua de la red de distribución de agua, incluyendo posibles riesgos identificados previamente, de acuerdo a los lineamientos técnicos emitidos por la COFEPRIS.

17. Enviar a la COFEPRIS informe mensual sobre los resultados del monitoreo de cloro residual realizado en la entidad federativa.

18. Enviar a la COFEPRIS informe mensual sobre las notificaciones realizadas a los responsables del abastecimiento del agua en localidades, municipios o entidades federativas, respecto a los resultados de los hallazgos obtenidos durante el monitoreo, así como de las acciones realizadas.

19. Enviar a la COFEPRIS reporte mensual sobre resultados de análisis bacteriológicos realizados conforme a los lineamientos establecidos, de acuerdo con la meta establecida entre la COFEPRIS y la entidad federativa.

20. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de Flúor, Arsénico, Plomo, Plaguicidas y/u otros analitos de riesgo en agua de uso y consumo humano priorizados por la entidad federativa.

21. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de playas prioritarias de acuerdo a lo establecido en los lineamientos establecidos por la COFEPRIS.

22. Enviar a la COFEPRIS informe mensual sobre la asistencia a las reuniones convocadas por los Comités de Playas, incluyendo información sobre los acuerdos generados durante dichas reuniones o las minutas correspondientes, en caso de que no se realicen se deberá informar en ese sentido.

23. Enviar a la COFEPRIS el reporte de resultados obtenidos del monitoreo de E. coli realizados en cuerpos de agua dulce para uso recreativo con contacto primario.

24. Implementar acciones de capacitación con el objetivo de disminuir riesgos asociados por el uso y consumo de agua, de acuerdo a los lineamientos emitidos por la COFEPRIS.

25. Coordinar estrategias de difusión con el objetivo de disminuir los riesgos asociados al uso y consumo de agua, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

LESP

26. Realizar los análisis bacteriológicos conforme a la meta y lineamientos establecidos.

27. Realizar los análisis de Flúor, Arsénico, Plomo, Plaguicidas y/u otros analitos de riesgo en agua de uso y consumo humano conforme a la meta y lineamientos establecidos.

28. Realizar los análisis del monitoreo de playas prioritarias conforme a la meta y lineamientos establecidos.

29. Realizar los análisis de E. coli en cuerpos de agua dulce para uso recreativo con contacto primario conforme a la meta y lineamientos establecidos.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Incrementar el número de notificaciones de RAMs recibidas por las entidades federativas. Utilizar a la Farmacovigilancia como herramienta que permita conocer el perfil de seguridad de los medicamentos. Fomentar actividades de Farmacovigilancia mediante la capacitación constante.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

30. Elaborar el plan de trabajo anual.

31. Implementación y seguimientos de unidades del sistema nacional de salud.

32. Elaborar el reporte mensual.

33. Realizar capacitaciones en materia de Farmacovigilancia.

34. Realizar asesorías en Farmacovigilancia.

35. Congreso Estatal de Farmacovigilancia.

36. Acudir a la reunión nacional.

37. Elaborar reporte final de actividades.

38. Coordinar estrategias de difusión en el tema de farmacovigilancia dirigidas al personal de salud y a la población en general, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Disminuir riesgos sanitarios a través de la vigilancia basada en riesgos.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

39. Implementar el Programa de Vigilancia Sanitaria en materia de productos y servicios, basado en riesgos así como: Realizar visitas de verificación sanitaria en materia de productos y servicios, para conocer las condiciones sanitarias de los establecimientos y productos relacionados, a fin de proteger a la población de riesgos sanitarios.

40. Realizar visitas de verificación sanitaria en establecimientos dedicados a la fabricación, venta y distribución de SUPLEMENTOS ALIMENTICIOS (PRODUCTOS ENGAÑO) para conocer las condiciones sanitarias de los establecimientos y productos relacionados, a fin de proteger a la población de riesgos sanitarios.

41. Realizar visitas de verificación sanitaria para vigilar el cumplimiento de la modificación de la NOM-051-SCFI/SSA1-2010, para conocer el cumplimento de los productos relacionados, a fin de proteger a la población de riesgos sanitarios.

42. Realizar visitas de verificación sanitaria en establecimientos dedicados al sacrificio y faenado de productos cárnicos (RASTROS y MATADEROS), para constatar las condiciones sanitarias en las que operan los establecimientos, a fin de proteger a la población de riesgos sanitarios.

43. Realizar el muestreo de los productos cárnicos para determinación de Clenbuterol en Rastros, Mataderos y Puntos de venta, durante la verificación sanitaria de conformidad con lo establecido en los lineamientos emitidos para este fin.

44. Realizar visitas de verificación sanitarias en establecimientos de los Sistemas Estatales DIF (comedores, asilos, guarderías, alberges, centros de atención múltiples y de rehabilitación, centros asistenciales de desarrollo infantil entre otros) con el objetivo de conocer las acciones y medidas establecidas para asegurar la calidad e inocuidad alimentaria, a fin de proteger a la población de riesgos sanitarios.

45. Realizar visitas de verificación sanitaria en materia de Establecimientos Especializados en la Atención de las Adicciones, por Saneamiento Básico y por Atención Medica Ambulatoria.

46. Realizar las visitas de verificación a los establecimientos del Sector Salud que realizan estudios de mastografía.

47. Atender las solicitudes de evaluación de condiciones sanitarias de los bienes asegurados en los almacenes (fiscalizados o no) del Instituto para Devolver al Pueblo lo Robado, la Fiscalía General de la República y el Sistema de Administración Tributaria que garanticen la inocuidad de los bienes asegurados, que sean susceptibles de entregar en Donación.

LESP

48. Realizar el análisis de los productos cárnicos para determinación de Clenbuterol en Rastros, Mataderos y Puntos de venta de conformidad con lo establecido en los lineamientos emitidos para este fin.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Incrementar el conocimiento de las medidas preventivas de protección a la salud relacionadas al saneamiento básico.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

49. Desarrollar la metodología de comunicación de riesgos en temas de saneamiento, en al menos una comunidad, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Implementar mecanismos de coordinación en materia de difusión, capacitación, supervisión y vinculación, orientados a fortalecer la rendición de cuentas, promover la integridad en el servicio público, prevenir actos discrecionales y/o de corrupción y dar certeza sobre la correcta ejecución de los procesos de regulación, control y fomento sanitario.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

50. Suscribir la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

51. Difundir la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario en los medios estatales.

52. Establecer campañas de difusión en los medios estatales para que el sector regulado conozca los mecanismos implementados por el APCRS derivados de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

53. Formalizar instrumentos de colaboración en materia de prevención de la corrupción, con cámaras y prestadores de servicios que se encuentren dentro del ámbito de competencia de la COFEPRIS y las APCRS.

54. Elaborar un apartado específico de difusión institucional dentro de los sitios web oficiales de las APCRS, destinado a dar a conocer la implementación de las acciones específicas de la Estrategia Nacional.

55. Participar en el programa de capacitación nacional sobre procesos de autorización, verificación y vinculación con los sectores público, privado y social.

56. Promover la participación en la supervisión de los procesos de autorización, verificación y vinculación con el sector público, privado y social que realizará la COFEPRIS.

57. Instalar y poner en funcionamiento cámaras de videograbación de solapa durante verificaciones sanitarias.

58. Instalar y poner en funcionamiento salas multidisciplinarias que cuenten con cámaras de videograbación para brindar atención al sector regulado.

59. Establecer un centro de monitoreo para la evaluación y análisis de las videograbaciones resultantes de las verificaciones sanitarias y de la atención al sector regulado.

60. Capacitar a las personas servidoras públicas en materia de prevención de actos de corrupción, así como fomentar la integridad en el ejercicio de sus funciones.

61. Promover un área específica de vinculación para turnar conocimiento a las instancias correspondientes en temas relacionados con presuntos actos de corrupción.

62. Enviar mensualmente los avances de la ejecución de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario.

63. Elaborar el informe final de la implementación de la Estrategia Nacional de Buen Gobierno en el Sistema Federal Sanitario en donde se describa el impacto de las acciones emprendidas.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Desarrollar, implementar y/o fortalecer los Sistemas de Gestión de la Calidad en el Sistema Federal Sanitario con base en la Norma ISO 9001:2015.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

64. Designar un enlace o responsable del SGC y su equipo de trabajo.

65. Constituir un Comité de la Calidad y establecer su procedimiento de funcionamiento.

66. Capacitar en los temas del SGC.

67. Conocer la organización y contexto (análisis FODA).

68. Crear, someter a autorización y difundir la Filosofía de la Calidad: Misión, Visión, Política de la Calidad y Objetivos de la Calidad.

69. Crear, someter a autorización y difundir el mapa y diagrama de procesos.

70. Determinar el alcance del SGC.

71. Describir las partes interesadas del SGC.

72. Determinar roles, responsabilidades y autoridades en el APCRS para el SGC.

73. Determinar los riesgos y oportunidades de los procesos establecidos en el SGC.

74. Crear, actualizar y controlar la información documentada del APCRS con base en los lineamientos de la Norma ISO 9001:2015.

75. Implementar actividades de seguimiento y medición de cumplimiento de objetivos.

76. Capacitar a auditores internos de calidad.

77. Generar evidencia de las revisiones del titular de la APCRS respecto al desarrollo, implementación, mantenimiento y/o fortalecimiento del Sistema de Gestión de la Calidad.

78. Gestionar con un organismo certificador acreditado por la Entidad Mexicana de Acreditación (EMA) la Auditoría externa de certificación, recertificación o mantenimiento del Sistema de Gestión de Calidad (para aquéllas APCRS que se encuentran en este proceso).

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Dar atención oportuna, organizada y sistemática a los eventos de emergencias sanitarias en materia de desastres naturales, brotes por enfermedades infecciosas y/o emergentes, eventos de concentración masiva, infecciones asociadas a la atención de la salud, bioterrorismo y/o exposición a otros agentes, a través de acciones de control sanitario.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

79. Notificar los eventos de emergencias sanitarias en un plazo no mayor a 24 horas, del conocimiento de ocurrencia e independientemente de la magnitud.

80. Contar con la evidencia del personal, desde nivel Jurisdiccional al Estatal (padrón de brigadistas), que fue capacitado en materia de emergencias sanitarias.

81. Remitir la evidencia de la adquisición de los insumos y materiales requeridos para la atención de emergencias sanitarias, incluyendo equipos de protección personal para el seguro desempeño de las funciones.

82. Enviar informe mensual y anual de atención a eventos de emergencias sanitarias.

83. Desarrollar y promover estrategias de difusión, con el fin de informar a la población en general, los riesgos a los que están expuestos y como evitarlos en circunstancias de emergencias sanitarias.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Mantener las acciones de control sanitario que garanticen la certificación y condición sanitaria de los sistemas de abastecimiento de agua públicos y privados de conformidad con la NOM-179-SSA1-2020, Agua para uso y consumo humano. Control de la calidad del agua distribuida por los sistemas de abastecimiento de agua. Las descargas de aguas residuales. Las características sanitarias y los criterios que deban cumplir los usuarios que aprovechen en su servicio aguas que posteriormente sean descargadas a cuerpos de agua destinadas al uso y consumo humano, el manejo adecuado de sustancias toxicas y residuos tóxicos, la protección y seguimiento a la salud de su personal ocupacionalmente expuesto.

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

APCRS

84. Enviar a la COFEPRIS el Padrón de Sistemas de Abastecimiento de Agua Públicos y Privados en el Estado.

85. Reportar mensualmente la certificación de sistemas de abastecimiento de agua para uso y consumo humano, públicos y privados, en municipios señalados en las RESAs (Anexo RESAs).

86. Realizar visitas de verificación a los sistemas de abastecimiento de agua para uso y consumo humano, públicos y privados, en municipios señalados en las RESAs (Anexo RESAs).

87. Realizar las acciones de fomento que correspondan con los Operadores de los sistemas de abastecimiento de agua públicos y privados, en los municipios que se han identificado en las RESAs. (Anexo RESAs).

88. Realizar visitas de verificación a empresas que residan dentro los municipios que conforman las Regiones de Emergencia Sanitaria y Ambiental (Anexo RESAs).

89. Realizar visitas de fomento a micro y pequeñas empresas que residan dentro los municipios que conforman las Regiones de Emergencia Sanitaria y Ambiental (Anexo RESAs).

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

Programa

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Fortalecimiento de la capacidad analítica conforme a los requerimientos establecidos, por la Comisión de Evidencia y Manejo de Riesgos (CEMAR) y Comisión de Operación Sanitaria (COS) responsables de los programas de vigilancia sanitaria; así como sistemas de gestión de calidad para el mantenimiento de la Autorización como Tercero Autorizado (TA).

Actividad Específica

Importes

Porcentaje de avance físico

Observaciones

Autorizado

Importe comprobado

Porcentaje de comprobación mensual

Por comprobar

LESP

90. Realizar el análisis de las determinaciones establecidas en los objetivos específicos del presente convenio, acorde al binomio matriz-analito, conforme a lo establecido en los lineamientos técnicos.

91. Ampliar la autorización de métodos de prueba, acorde a la capacidad instalada en cada LESP y conforme a lo establecido en los lineamientos técnicos.

92. Mantener vigente la Autorización como Laboratorio de Prueba Tercero Autorizado.

93. Cumplir con las actividades relacionadas con el fortalecimiento técnico, competencia técnica, el envío de informes de atención de muestras como Laboratorio de Prueba de Tercero Autorizado y el aprovechamiento de recursos, acorde a lo establecido en los lineamientos técnicos.

Total

La documentación justificativa y comprobatoria del recurso ejercido se encuentra en poder de la entidad federativa para los efectos de revisión por parte de las instancias fiscalizadoras correspondientes.

LOS SERVIDORES PÚBLICOS QUE INTERVIENEN EN LA ELABORACIÓN, SUSCRIPCIÓN Y RECEPCIÓN DE LOS RECURSOS OTORGADOS A TRAVÉS DEL PRESENTE CONVENIO DE COLABORACIÓN ENTRE LA COFEPRIS Y EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, DEBERÁN DAR CUMPLIMIENTO A LO ESTABLECIDO EN LA LEY FEDERAL DE AUSTERIDAD REPUBLICANA, SUS LINEAMIENTOS Y NORMAS ESPECÍFICAS DICTADAS SOBRE LA MATERIA POR LAS AUTORIDADES RESPONSABLES.

ANEXO 3 DEL CONVENIO ESPECÍFICO EN MATERIA DE TRANSFERENCIA DE RECURSOS FEDERALES CON EL CARÁCTER DE SUBSIDIOS, PARA FORTALECER LA EJECUCIÓN Y DESARROLLO DEL PROGRAMA Y PROYECTOS DE PROTECCIÓN CONTRA RIESGOS SANITARIOS, ASÍ COMO LA RED NACIONAL DE LABORATORIOS, QUE CELEBRAN POR UNA PARTE EL EJECUTIVO FEDERAL, POR CONDUCTO DE LA SECRETARÍA DE SALUD, A TRAVÉS DE LA COMISIÓN FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, Y POR LA OTRA, EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, EL QUINCE DE JUNIO DEL AÑO DOS MIL VEINTIDOS.

Por la Secretaría: el Comisionado Federal para la Protección contra Riesgos Sanitarios, Dr. Alejandro Ernesto Svarch Pérez .- Rúbrica.- La Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, C. Anahi Guadalupe Orozco .- Rúbrica.- Por la Entidad: la Secretaria de Planeación, Finanzas y Administración, C. Fabiola Verduzco Aparicio .- Rúbrica.- La Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, Dra. Martha Janeth Espinosa Mejía .- Rúbrica.- La Comisionada Estatal para la Protección contra Riesgos Sanitarios, Dra. Tania Irerí Ríos Cuevas .- Rúbrica.

ANEXO 4

PROGRAMA, RESPONSABLES POR UNIDAD ADMINISTRATIVA Y COORDINACIONES DE TEMAS

ENTIDAD:

COLIMA

CONCEPTO:

Fortalecimiento de la ejecución y desarrollo del Programa y Proyectos Federales de Protección contra Riesgos Sanitarios (Regulación y Fomento Sanitarios) y Fortalecimiento de la Red Nacional de Laboratorios (Laboratorio Estatal de Salud Pública)

PROGRAMA:

Protección contra Riesgos Sanitarios

CONVENIO CLAVE:

COFEPRIS-CETR-COL.-07-22

Programa

Objetivo Específico

UA Responsable

Coordinador

UA Encargada del seguimiento a los avances de las metas comprometidas en el programa

Coordinador

UA Encargada de conducir los trabajos de seguimiento y revisión de la documentación remitida por las entidades federativas relativas al avance físico financiero dentro del sistema electrónico autorizado.

UA Encargada del seguimiento y trámite de las solicitudes de transferencia y del reintegro de los recursos financieros.

UA Encargada del seguimiento de las Acciones de Difusión y Capacitación

Coordinador

UA Encargada del control analítico

Coordinador

Fortalecimiento al Sistema Federal Sanitario en materia de protección contra riesgos sanitarios.

Mantener las acciones de control sanitario que garanticen la inocuidad de los alimentos incluso durante las emergencias sanitarias (COVID-19).

COS

Dirección Ejecutiva de Programas Especiales

CGSFS

Dirección Ejecutiva de Programación y Evaluación del Desempeño

CGSFS

SG

CFS

Dirección Ejecutiva de Comunicación de Riesgos y Capacitación

CCAyAC

Dirección Ejecutiva de Innovación

Establecer un sistema de Alerta Temprana de Florecimientos de Algas Nocivas (Marea Roja), con el fin de aplicar medidas preventivas de manera oportuna, tendientes a evitar el consumo de moluscos bivalvos expuestos a mareas rojas tóxicas.

Dar atención oportuna, organizada y sistemática a los eventos de emergencias sanitarias en materia de desastres naturales, brotes por enfermedades infecciosas y/o emergentes, eventos de concentración masiva, infecciones asociadas a la atención de la salud, bioterrorismo y/o exposición a otros agentes, a través de acciones de control sanitario.

COS

Dirección Ejecutiva de Programas Especiales

Disminuir riesgos sanitarios a través de la vigilancia basada en riesgos.

Dirección Ejecutiva de Supervisión y Vigilancia Sanitaria

Dirección Ejecutiva de Supervisión y Vigilancia Sanitaria

Mantener las acciones de control sanitario que garanticen la certificación y condición sanitaria de los sistemas de abastecimiento de agua públicos y privados de conformidad con la NOM-179-SSA1-2020, Agua para uso y consumo humano. Control de la calidad del agua distribuida por los sistemas de abastecimiento de agua. Las descargas de aguas residuales. Las características sanitarias y los criterios que deban cumplir los usuarios que aprovechen en su servicio aguas que posteriormente sean descargadas a cuerpos de agua destinadas al uso y consumo humano, el manejo adecuado de sustancias toxicas y residuos tóxicos, la protección y seguimiento a la salud de su personal ocupacionalmente expuesto.

Proteger a la población de riesgos potencialmente presentes en el agua de uso y consumo humano (Incluye agua de consumo, para la preparación de alimentos e higiene, así como para actividades recreativas en agua).

CEMAR

Dirección Ejecutiva de Evidencia de Riesgos

CFS

Dirección Ejecutiva de Comunicación de Riesgos y Capacitación

Incrementar el número de notificaciones de RAMs recibidas por las entidades federativas.

Utilizar a la Farmacovigilancia como herramienta que permita conocer el perfil de seguridad de los medicamentos.

Fomentar actividades de Farmacovigilancia mediante la capacitación constante.

Dirección Ejecutiva de Ejecutiva de Farmacopea y Farmacovigilancia

Incrementar el conocimiento de las medidas preventivas de protección a la salud relacionadas al saneamiento básico.

CFS

Dirección Ejecutiva de Comunicación de Riesgos y Capacitación

Implementar mecanismos de coordinación en materia de difusión, capacitación, supervisión y vinculación, orientados a fortalecer la rendición de cuentas, promover la integridad en el servicio público, prevenir actos discrecionales y/o de corrupción y dar certeza sobre la correcta ejecución de los procesos de regulación, control y fomento sanitario.

CGSFS

Dirección Ejecutiva de Programación y Evaluación del Desempeño

CGSFS

Dirección Ejecutiva de Programación y Evaluación del Desempeño

Desarrollar, implementar y/o fortalecer los Sistemas de Gestión de la Calidad en el Sistema Federal Sanitario con base en la Norma ISO 9001:2015.

Fortalecimiento de la capacidad analítica conforme a los requerimientos establecidos, por la Comisión de Evidencia y Manejo de Riesgos (CEMAR) y Comisión de Operación Sanitaria (COS) responsables de los programas de vigilancia sanitaria; así como sistemas de gestión de calidad para el mantenimiento de la Autorización como Tercero Autorizado (TA).

CCAYAC

Dirección Ejecutiva de Innovación

CCAYAC

Dirección Ejecutiva de Innovación

CCAyAC

Dirección Ejecutiva de Innovación

LOS SERVIDORES PÚBLICOS QUE INTERVIENEN EN LA ELABORACIÓN, SUSCRIPCIÓN Y RECEPCIÓN DE LOS RECURSOS OTORGADOS A TRAVÉS DEL PRESENTE CONVENIO DE COLABORACIÓN ENTRE LA COFEPRIS Y EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, DEBERÁN DAR CUMPLIMIENTO A LO ESTABLECIDO EN LA LEY FEDERAL DE AUSTERIDAD REPUBLICANA, SUS LINEAMIENTOS Y NORMAS ESPECÍFICAS DICTADAS SOBRE LA MATERIA POR LAS AUTORIDADES RESPONSABLES.

ANEXO 4 DEL CONVENIO ESPECÍFICO EN MATERIA DE TRANSFERENCIA DE RECURSOS FEDERALES CON EL CARÁCTER DE SUBSIDIOS, PARA FORTALECER LA EJECUCIÓN Y DESARROLLO DEL PROGRAMA Y PROYECTOS DE PROTECCIÓN CONTRA RIESGOS SANITARIOS, ASÍ COMO LA RED NACIONAL DE LABORATORIOS, QUE CELEBRAN POR UNA PARTE EL EJECUTIVO FEDERAL, POR CONDUCTO DE LA SECRETARÍA DE SALUD, A TRAVÉS DE LA COMISIÓN FEDERAL PARA LA PROTECCIÓN CONTRA RIESGOS SANITARIOS, Y POR LA OTRA, EL EJECUTIVO DEL ESTADO LIBRE Y SOBERANO DE COLIMA, EL QUINCE DE JUNIO DEL AÑO DOS MIL VEINTIDOS.

Por la Secretaría: el Comisionado Federal para la Protección contra Riesgos Sanitarios, Dr. Alejandro Ernesto Svarch Pérez .- Rúbrica.- La Secretaria General de la Comisión Federal para la Protección contra Riesgos Sanitarios, C. Anahi Guadalupe Orozco .- Rúbrica.- Por la Entidad: la Secretaria de Planeación, Finanzas y Administración, C. Fabiola Verduzco Aparicio .- Rúbrica.- La Secretaria de Salud y Presidenta Ejecutiva de los Servicios de Salud del Estado de Colima, Dra. Martha Janeth Espinosa Mejía .- Rúbrica.- La Comisionada Estatal para la Protección contra Riesgos Sanitarios, Dra. Tania Irerí Ríos Cuevas .- Rúbrica.

ANEXO 5

CATÁLOGO DE INSUMOS

ENTIDAD:

COLIMA

CONCEPTO:

Fortalecimiento de la ejecución y desarrollo del Programa y Proyectos Federales de Protección contra Riesgos Sanitarios (Regulación y Fomento Sanitarios) y Fortalecimiento de la Red Nacional de Laboratorios (Laboratorio Estatal de Salud Pública)

PROGRAMA:

Protección contra Riesgos Sanitarios

CONVENIO CLAVE:

COFEPRIS-CETR-COL.-07-22

Programa

Fortalecimiento al sistema federal sanitario en materia de Protección contra Riesgos Sanitarios.

Objetivo

Proteger a la población contra riesgos a la salud provocados por el uso y consumo de bienes y servicios, insumos para la salud, así como por su exposición a factores ambientales y laborales la ocurrencia de emergencias sanitarias, incluido COVID-19 y la prestación de servicios de salud mediante la regulación, control y prevención de riesgos sanitarios.

Objetivo Específico

Mantener las acciones de control sanitario que garanticen la inocuidad de los alimentos incluso durante las emergencias sanitarias (COVID-19).

Actividad específica

Claves de partida

Partida específica

Insumo

APCRS

1. Enviar a la COFEPRIS el padrón de establecimientos que empacan productos agrícolas frescos o mínimamente procesados en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

21101; 21401; 31701.

MATERIALES Y ÚTILES DE OFICINA; MATERIALES Y ÚTILES CONSUMIBLES PARA EL PROCESAMIENTO EN EQUIPOS Y BIENES INFORMÁTICOS; SERVICIOS DE CONDUCCIÓN DE SEÑALES ANALÓGICAS Y DIGITALES.

Papelería en general; insumos para impresoras y memorias usb; servicio de internet.

2. Realizar visitas de verificación a los establecimientos que procesan los productos agrícolas frescos y mínimamente procesados (hortalizas y/o frutas) (APCRS).

21101; 21401; 21601; 25501; 26102; 27201; 29601; 35501; 37201.

MATERIALES Y ÚTILES DE OFICINA; MATERIALES Y ÚTILES CONSUMIBLES PARA EL PROCESAMIENTO EN EQUIPOS Y BIENES INFORMÁTICOS; MATERIAL DE LIMPIEZA; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; COMBUSTIBLES, LUBRICANTES Y ADITIVOS PARA VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES DESTINADOS A SERVICIOS PÚBLICOS Y LA OPERACIÓN DE PROGRAMAS PÚBLICOS; PRENDAS DE PROTECCIÓN PERSONAL; REFACCIONES Y ACCESORIOS MENORES DE EQUIPO DE TRANSPORTE; MANTENIMIENTO Y CONSERVACIÓN DE VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES; PASAJES TERRESTRES NACIONALES PARA LABORES EN CAMPO Y DE SUPERVISIÓN.

Materiales y útiles de oficina; insumos para impresoras y memorias USB; gel antibacterial; alcohol o solución desinfectante; comparadores colorimétricos; jabón; combustibles, aditivos y lubricantes para vehículos; gasolina; equipo de protección personal (cofias o cubrepelo, cubrebocas, googles, guantes de látex); llantas para vehículo; servicio de mantenimiento preventivo y correctivo para vehículos; casetas/peaje; gastos de camino.

3. Realizar la toma de muestras y envío de las mismas al LESP de los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a las cuales se efectuarán las determinaciones especificadas en la programación correspondiente y que deben coincidir con las registradas en el apartado del LESP (APCRS).

21101; 21601; 25101; 25501; 26102; 29601; 31801; 33603; 33901; 35501; 37201.

MATERIALES Y ÚTILES DE OFICINA; MATERIAL DE LIMPIEZA; PRODUCTOS QUÍMICOS BÁSICOS; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; COMBUSTIBLES, LUBRICANTES Y ADITIVOS PARA VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES DESTINADOS A SERVICIOS PÚBLICOS Y LA OPERACIÓN DE PROGRAMAS PÚBLICOS; REFACCIONES Y ACCESORIOS MENORES DE EQUIPO DE TRANSPORTE; SERVICIO POSTAL; IMPRESIONES DE DOCUMENTOS OFICIALES PARA LA PRESTACIÓN DE SERVICIOS PÚBLICOS, IDENTIFICACIÓN, FORMATOS ADMINISTRATIVOS Y FISCALES, FORMAS VALORADAS, CERTIFICADOS Y TÍTULOS; SUBCONTRATACIÓN DE SERVICIOS CON TERCEROS; MANTENIMIENTO Y CONSERVACIÓN DE VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES; PASAJES TERRESTRES NACIONALES PARA LABORES EN CAMPO Y DE SUPERVISIÓN.

Cubrepelo; guantes estériles; alcohol o solución desinfectante; bolsas; bolsas de cierre hermético estériles; bolsas de polietileno transparente autosellables estériles; comparadores colorimétricos; cinta canela; etiqueta autoadherible para identificación de muestra; jabón; tabla con clip acrílico; bolsa para toma de muestra doble sello; gel antibacterial para manos; sanitas; papel interdoblado; glicerina purificada; solución de almacenaje; solución de conductividad; congelador; frasco de boca ancha con tapa hermética; hielera; hisopo y torunda de algodón; kit digital para determinación de cloro residual y ph (medidor de ph y cloro); pastilla dpd para pruebas de cloro residual libre; rollo de bolsa de polietileno; sello de muestreo; termómetro; utensilios para visitas técnicas y toma de muestras (cucharas, pinzas, picahielos, espátula, frascos de nalgene); combustibles, aditivos y lubricantes para vehículos; gasolina; cubrebocas; equipo de protección personal: (cofias, cubrebocas, googles, guantes de látex); guantes; llantas para vehículo; guía de estafeta para envío de muestras de alimentos; material impreso; sellos autoadheribles para muestreo; pago de determinaciones analíticas en laboratorio tercero autorizado de plaguicidas en alimentos; subcontratación de servicios con terceros; servicio de mantenimiento preventivo y correctivo para vehículos; casetas/peaje; gastos de camino.

4. Notificar los resultados de análisis los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), a la COFEPRIS de manera mensual en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

21101; 21401; 31701.

MATERIALES Y ÚTILES DE OFICINA; MATERIALES Y ÚTILES CONSUMIBLES PARA EL PROCESAMIENTO EN EQUIPOS Y BIENES INFORMÁTICOS; SERVICIOS DE CONDUCCIÓN DE SEÑALES ANALÓGICAS Y DIGITALES.

Papelería en general; insumos para impresoras y memorias usb; servicio de internet.

5. Cumplir con el número de visitas programadas para la toma de muestras de agua y producto en las áreas de cosecha de moluscos bivalvos, así como el envío de muestras a los LESP (APCRS).

21101; 25501; 26102; 27101; 29601; 32505; 33604; 33901; 35501; 37501.

MATERIALES Y ÚTILES DE OFICINA; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; COMBUSTIBLES, LUBRICANTES Y ADITIVOS PARA VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES DESTINADOS A SERVICIOS PÚBLICOS Y LA OPERACIÓN DE PROGRAMAS PÚBLICOS; VESTUARIO Y UNIFORMES; REFACCIONES Y ACCESORIOS MENORES DE EQUIPO DE TRANSPORTE; ARRENDAMIENTO DE VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES PARA SERVIDORES PÚBLICOS; IMPRESIÓN Y ELABORACIÓN DE MATERIAL INFORMATIVO DERIVADO DE LA OPERACIÓN Y ADMINISTRACIÓN DE LAS DEPENDENCIAS Y ENTIDADES; SUBCONTRATACION DE SERVICIOS CON TERCEROS; MANTENIMIENTO Y CONSERVACIÓN DE VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES; VIÁTICOS NACIONALES PARA LABORES EN CAMPO Y DE SUPERVISIÓN.

Baterías; cinta canela/cinta testigo; etiqueta autoadherible para identificación de muestra; material impreso; tabla de apoyo para campo con clip; bolsa de plástico; gel antibacterial; bolsa estéril con cierre hermético para toma de muestra; frasco de boca ancha con tapa hermética; frasco de plástico esterilizable; GPS; hielera y caja térmica de plástico o polipropileno; refrigerante; termómetro; gasolina; chalecos salvavidas; refacciones de vehículos; arrendamiento de lancha; pago de peaje en carreteras; análisis de muestras; servicio de mantenimiento preventivo y correctivo para vehículos; medidor de oxígeno disuelto, temperatura y ph.

6. Notificar los resultados de análisis de las determinaciones realizadas en agua y producto a la COFEPRIS de manera mensual a través del sistema electrónico autorizado en el formato oficial y de conformidad con los lineamientos correspondientes (APCRS).

21101; 21401; 31701.

MATERIALES Y ÚTILES DE OFICINA; MATERIALES Y ÚTILES CONSUMIBLES PARA EL PROCESAMIENTO EN EQUIPOS Y BIENES INFORMÁTICOS; SERVICIOS DE CONDUCCIÓN DE SEÑALES ANALÓGICAS Y DIGITALES.

Papelería en general; cartucho officejet; memorias USB.

7. Elaborar, promover y coordinar un programa de capacitación en materia de inocuidad de los alimentos dirigida a los manejadores de alimentos.

37201; 26102; 32301; 32302; 52901.

PASAJES TERRESTRES NACIONALES PARA LABORES EN CAMPO Y DE SUPERVISIÓN; COMBUSTIBLES, LUBRICANTES Y ADITIVOS PARA VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES DESTINADOS A SERVICIOS PÚBLICOS Y LA OPERACIÓN DE PROGRAMAS PÚBLICOS; ARRENDAMIENTO DE EQUIPO Y BIENES INFORMÁTICOS; ARRENDAMIENTO DE MOBILIARIO; OTRO MOBILIARIO Y EQUIPO EDUCACIONAL Y RECREATIVO.

Pasajes terrestres nacionales; papelería en general; insumos para impresoras; servicio de internet; servicios de cómputo; peajes; bocinas; micrófonos; proyector; componentes de equipo de cómputo; gasolina y viáticos.

8. Coordinar estrategias de difusión, dirigidas a manejadores de alimentos y a la población en general, con el propósito de contribuir a la disminución de los riesgos sanitarios asociados con el consumo de alimentos, de acuerdo a los lineamientos emitidos por la Comisión de Fomento Sanitario.

31603; 31602; 21201; 21501; 36101; 37201; 33604; 33605; 26102.

SERVICIOS DE INTERNET; SERVICIOS DE TELECOMUNICACIONES; MATERIALES Y ÚTILES DE IMPRESIÓN Y REPRODUCCIÓN; MATERIAL DE APOYO INFORMATIVO; DIFUSIÓN DE MENSAJES SOBRE PROGRAMAS Y ACTIVIDADES GUBERNAMENTALES; PASAJES TERRESTRES NACIONALES PARA LABORES EN CAMPO Y DE SUPERVISIÓN; IMPRESIÓN Y ELABORACIÓN DE MATERIAL INFORMATIVO DERIVADO DE LA OPERACIÓN Y ADMINISTRACIÓN DE LAS DEPENDENCIAS Y ENTIDADES; INFORMACIÓN EN MEDIOS MASIVOS DERIVADA DE LA OPERACIÓN Y ADMINISTRACIÓN DE LAS DEPENDENCIAS Y ENTIDADES; COMBUSTIBLES, LUBRICANTES Y ADITIVOS PARA VEHÍCULOS TERRESTRES, AÉREOS, MARÍTIMOS, LACUSTRES Y FLUVIALES DESTINADOS A SERVICIOS PÚBLICOS Y LA OPERACIÓN DE PROGRAMAS PÚBLICOS.

Viáticos; pasajes; publicaciones especializadas, folletos, catálogos, formatos y otros productos mediante cualquier técnica de impresión y sobre cualquier tipo de material. Incluye impresión sobre prendas de vestir, producción de formas continuas, impresión rápida, elaboración de placas, clichés y grabados; materiales impresos; internet; viáticos; peajes; componentes de equipo de cómputo; gasolina; servicios de apoyo administrativo, traducción, fotocopiado e impresión; impresión y elaboración de material informativo derivado de la operación y administración de las dependencias y entidades; información en medios masivos derivada de la operación y administración de las dependencias y entidades; material de apoyo informativo.

LESP

9. Realizar las determinaciones especificadas en las sábanas de muestreo a los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), de conformidad con lo establecido en los lineamientos emitidos para este fin (LESP).

21601; 25101; 25501; 25901; 27201; 33901; 32401; 53101; 53201; 59101.

MATERIAL DE LIMPIEZA; PRODUCTOS QUÍMICOS BÁSICOS; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; OTROS PRODUCTOS QUÍMICOS; PRENDAS DE PROTECCIÓN PERSONAL; SUBCTONTRATACIÓN DE SERVICIOS CON TERCEROS; ARRENDAMIENTO DE EQUIPO E INSTRUMENTAL MÉDICO Y DE LABORATORIO; EQUIPO MÉDICO Y DE LABORATORIO; INSTRUMENTAL MÉDICO Y DE LABORATORIO; SOFTWARE.

Agar urea de christensen, accesorios para homogeneizador peristáltico; aceite de parafina; aceite de inmersión; acetona; acetonitrilo; ácido acético glacial; ácido bórico; ácido clorhídrico; ácido cromotrópico; ácido fosfórico; agar arginina glucosa inclinado; agar azul de toluidina; agar bacteriológico; agar Baird-Parker; agar base sangre; agar base urea; agar bilis rojo; violeta(RVBA); agar bilis glucuronido; agar celobiosa polimixina colistina modificado mCPC; agar citrato de Simmons; agar cromogénico para vibrio; agar cuenta estándar; agar de hierro klinger; agar EMB según Levine; agar eosina azul de metileno de Levin; agar hektoen entérico; agar hierro triple azúcares (TSI); agar hierro-lisina; agar inclinado arginina glucosa; agar MacConkey; agar medio movilidad; agar métodos cuenta estándar; agar nutritivo; agar sacarosa V. parahaemolyticus (VPSA); agar sabouraud con dextrosa para el cultivo de hongos; agar sal y manitol, para el aislamiento de staphylococcus patógenos; agar sangre; agar SIM; agar soya tripticasa; agar soya tripticasa sulfato de magnesio; agar soya tripticaseína; agar sulfito de bismuto (ASB); agar T1N1 y T1N3; agar tiosulfato de sodio; agar tiosulfato de sodio citrato sales biliares sacarosa (TCBS); agar triple azúcar hierro (TSI); agar triptona bilis x-glucoronido; agar triptosa, base de sangre; agar urea de Chritensen; agar verde brillante; agar xilosa lisina desoxicolato (XLD); agar-agar base para la preparación de medios de cultivo; agarosa; agarosa grado biología molecular libre de nucleasa; agitador digital con calefacción; agua destilada; agua HPLC; agua grado biología molecular; agua peptonada alcalina; agua peptonada amortiguada; agua tipo 1; alcohol etílico grado reactivo; alúmina para cromatografía en columna; ampolletas bioindicadoras (bacilos estearothermophilus); ampolletas bioindicadoras; ampolletas bioindicadoras de esterilidad; ampolletas de bacillus stearothermophilus para esterilización en autoclave; antisuero monovalente Ogawa; anti-Dig AP [Anti-digoxigenina fosfatasa alcalina, fragmentos Fab]; antisuero de conejo policlonal liofilizado; antisuero de vibrio cholerae O139; antisuero monoespecífico salmonella O: B, C, D, E, F, G, H, I; antisuero monovalente Inaba; antisuero monovalente Ogawa.

LESP

9. Realizar las determinaciones especificadas en las sábanas de muestreo a los productos de la pesca, cárnicos, lácteos, huevo y productos agrícolas mínimamente procesados (hortalizas y/o frutas), de conformidad con lo establecido en los lineamientos emitidos para este fin (LESP).

21601; 25101; 25501; 25901; 27201; 33901; 32401; 53101; 53201; 59101.

MATERIAL DE LIMPIEZA; PRODUCTOS QUÍMICOS BÁSICOS; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; OTROS PRODUCTOS QUÍMICOS; PRENDAS DE PROTECCIÓN PERSONAL; SUBCTONTRATACIÓN DE SERVICIOS CON TERCEROS; ARRENDAMIENTO DE EQUIPO E INSTRUMENTAL MÉDICO Y DE LABORATORIO; EQUIPO MÉDICO Y DE LABORATORIO; INSTRUMENTAL MÉDICO Y DE LABORATORIO; SOFTWARE.

antisuero monovalente para vibrio cholerae Oagawa; antisuero para Vibrio Cholerae Ogawa; antisuero polivalente de vibrio cholerae 01; antisuero polivalente o salmonella poly B, C, D; antisuero polivalente O:A-I+Vi; antisuero somático (O) polivalente de salmonella; antisuero Vibrio cholerae polivalente; asas bacteriológicas; asas de nicromel; asas de platino-iridio; asas de poliestireno; asas desechables; autoclave; auxiliar de macropipeteado con filtro de membrana de recambio; balanza analítica; balanza granataria; baños de agua ; base agar urea; base Moeller descarboxilasa; bata; bioindicador Sterikon plus; bioquímicas miniaturizadas API 20 E; bolsas de papel para esterilizar material; bolsas de polietileno para homogeneizador peristáltico; bolsas stomacher; bolsa de dilución de vidrio; bolsas y contenedores rígidos para depositar residuos o material RPBI; bomba de vacío; bote de polipropileno autolavable con tapa rosca; bote de polipropileno blanco con tapa de rosca; botellas con tapa de rosca; bromuro de etidio; BRU1S711F GCTTGAAGCTTGCGGACAGT; BRU1S711R GGCCTACCGCTGCGAAT; brucella spp; buffer de referencia estándar; buffer de referencia ph 10.0; buffer de referencia pH 4.0; buffer salino de fosfatos (PBS); cabina de PCR; cabina de seguridad biológica (CBS); cadena de la polimerasa

(PCR); caja petri estéril; caldo agar soya tripticasa; caldo base de Muller descarboxilasa; caldo BHI; caldo carbohidrato (ramnosa y xilosa); caldo cianuro de potasio (KCN); caldo citrato de Kosher; caldo de urea; caldo Dey-Engley; caldo (E. coli); caldo EC con mug; caldo glutamato con minerales modificado; caldo infusión, cerebro corazón (BHI); caldo lactosado; caldo lauril triptosa; caldo lauril sulfato de sodio; caldo lisina descarboxilasa; caldo malonato; caldo mineral modificado con glutamato; caldo MR-VP; caldo mueller- kauffman tetrationato - novobiocina; caldo nutritivo; caldo peptona de caseína; caldo peptonado; caldo púrpura para carbohidratos; caldo Rappaport-vassiliadis; caldo rojo de fenol; caldo soya tripticaseína; caldo soya-tripticaseína con sulfato ferroso; caldo soya-tripticaseína-triptosa; caldo tetrationato; caldo triptona (triptófano); caldo triptona y caldo triptona con cloruro de sodio; caldo universal de preenriquecimiento; caldo urea para diferenciar e identificar enterobacterias; caldo verde brillante lactosa bilis; caldos T1N0, T1N3, T1N6, T1N8, T1N10; cámara de electroforesis;

cámara húmeda; campana de bioseguridad tipo 2; campana de extracción; campana de flujo laminar; campanas de fermentación Durham; celdas; celdas para espectrofotómetro; centrifuga; cepas de staphylococcus aureus; cepas de Staphylococcus epidermidis; cinta testigo para procesos de esterilización por calor húmedo; citrato de Simmons ; citrato de solución salina estándar; citrato férrico; citrato férrico amónico; citrato sales biliares sacarosa (TCBS); cloruro de amonio; cloruro de sodio; clorhidrato de lisozima; cloruro de benzalconio; cloruro de calcio anhidro; cloruro de magnesio hexahidratado; cloruro de sodio; cofias; colorante azul de bromotimol; colorante azul de toludina; colorante purpura de bromocresol; colorante verde brillante; columna cromatografíca de vidrio; columnas capilares; congelador; cono de hilo de algodón para hisopo de Spira; control biológico de esterilización; cristales de fosfato de creatina; cristales de monohidrato de creatina; cubrebocas; cromatógrafo de Gases con detectores selectivos; cronómetro; cubrezapatos; cucharas para transferir muestras; cuchillos; Data loggers para autoclave; densímetro digítal; desconchadores; desoxicolato de sodio; destilador de ácidos; detergente neutro y alcalino para lavado de material de laboratorio; dexosicolato de sodio; dextrosa anhidra; diclorometano; gigerido enzimático de caseína; digestor de muestras por microondas; diluyente peptona-tween-sal (PTS); dinucleótidos trifosfato (dNTP's); discos de ONPG; discos de papel; dispensador de líquidos; DNA; DNAsA; E.coli ATCC 25922 o ATCC 8739; E. faecalis ATCC 29212 o ATCC 19433; EDTA disódico dihidratado; electrodo; etanol; combinado de pH; electrodo de pH plano para agares; electrodo de pH para líquidos; electrodos; embudo büchner de porcelana; embudo de separación; embudo de vidrio; emulsión de yema de huevo; enriquecimiento de telurito EY; enterobacter aerogenes ATCC 13048; enterotoxina; enzima taqman; equipo de filtración por membrana; equipo medidor de pH escalpelo de acero inoxidable; equipo para cuantificación de ácidos nucleicos; escalpelo de acero inoxidable; espátulas; espectrofotómetro UV-VIS; estuche comercial high pure template preparation kit; etanol; éter de petróleo; éter etílico; extracto de levadura; ltros de membrana; florisil; fosfato de potasio monobásico;

fosfato de sodio dibásico anhidro; fi fosfato de sodio dibásico dodecahidratado; fosfato de sodio; fosfato de sodio disódico; fosfato disódico anhidro dihidratado; fosfato mono potásico; fosfato monobásico de potasio; frasco de plástico; frasco de polipropileno; frasco de vidrio ámbar; frascos con tapa de rosca esterilizable; frascos de dilución; frascos de dilución de vidrio de borosilicato con tapón esmerilado; fuente de poder; gabinete de fulo laminar clase II; gabinete de bioseguridad; gasas; gasa simple; gelatina nutritiva; Gen r72h VPR72H-F 387 pb; Gen r72h VPR72H-R 320 pb; Gen tdh VPTDH-F 270 pb; Gen tdh VP-TDH-R 270 pb; Gen trh VPTRH-F 486 pb; glicerina purificada; glucosa; gradillas isotérmicas; gradilla de plástico; gradillas de metal; guantes de latex; guante de malla de acero inoxidable; guantes de nitrilo; guantes termo-resistente; hexano; hidroclorido de lisozima; hidróxido de potasio; hidróxido de sodio; hidróxido de sodio lentejas; hipoclorito de sodio; hisopo de alambre para hisopos de moore; homogeneizador peristáltico; horno esterilizante; IAC 186R GGCCTACCGCTGCGCAAT; IAC 46F GCTTGAAGCTTGCGGACAGT; IAC sonda TCTCATGCGTCTCCCTGGTGAATGTG; incubadora; incubador microbiológico con cámara de acero inoxidable; incubadora bacteriológica; incubadora de microplacas; incubadora digital precisión; indicador de esterilidad para horno calor seco; Iniciadores Bru; indicador rojo de metilo; Isopropanol absoluto; jeringa estéril desechable; Juego de alcoholímetros; Kit para extracción de ADN; kit ridascreen set total; klebsiella pneumoniae; lana de vidrio; lámpara de luz uv; l-arginina; leche descremada, desecada (reconstituida); lentes protectores; lector de microplaca ELISA; licuadora; L-lactosa monohidratada; L-triptofano; martillo; marcador de peso molecular; material de limpieza; material de vidrio; maltosa para añadir a medios de cultivo; jabón; matraces Erlenmeyer; Matraces volumétricos; matraz de bola de vidrio de fondo plano; matraz Kitazato; matraz Erlenmeyer de vidrio borosilicato con labio; Matraz volumétrico; mechero bunsen; medio AKI; medidor portátil de pH; medio de caldo lactosado; medio de Brucella spp; medio MIO para identificar enterobacterias; medio para prueba de movilidad; medio Rappaport-Vassiliadis; medio t.b.x. medio de cultivo para la

cuantificación de coliformes fecales; medio triptona-bilis-glucoronido (TBX); mensajería; microcentriguga; micropipeta; micropipetas calibradas y/o verificadas; micropipetas de volumen variable; micropipeta multicanal; microscopio; microtubos; minicentrifuga;mineral estéril; motor de licuadora para homogenizador peristáltico; N-Heptano; NIT1 (X2) + NIT2 (X2); novobiocina vial; ONPG; oligonucleótidos; oxalato de verde de malaquita; palitos aplicadores de madera; palillos de madera; papel absorbente; papel aluminio; papel bond; papel filtro Whatman; papel indicador de pH; papel parafilm; parrilla eléctrica; PCR nucleotide mix; peines para cámara de electroforesis; película adhesiva MicroAmp Optical Adhesive film; peptona de caseína; peptona babteriológica; peróxido de hidrógeno; picnometro; pinzas; pinzas de disección; pipeta; pipetor electrónico; placa de 96 pozos para PCR; placa de calentamiento; placas con 96 pozos de fondo plano con tapa; placas de microtitulación; plasma de conejo con EDTA; porta objetos para microscopio; potenciómetro; probeta; puntas para micropipetas; púrpura de bromocresol; rack abridor para bolsa stomacher; refrigerador; reactivo de beta galactosidasa; reactivo de kovacs; reactivo de ONPG; reactivo de oxidasa; reactivo desoxicolato de sodio; reactivo de Voges-Proskauer; reactivo API20E; reactivos para la coloración de GRAM; reactivos para la prueba de Voges-Proskauer; reactivos para la tinción de Gram; recipientes de plástico; refrigerador; regulador salina de fosfatos (PBS) para extracción de ADN; regulador de fosfatos solución concentrada; rejilla base, metálica, circular; reservorio de plástico; rotavapor; S. abortus equi ATCC 9842, 12325, 29934; sal de ácido desoxiribonucleico de timo de carnero; sal sódica; salmonella typhimurium ATCC 14028; separador de huevo; sistema de calentamiento; sistema de destilación o microdestilador; sistema fotodocumentador o sistema digital de imágenes; sistema vitek; solución amortiguadora pH; solución buffer; solución de bromocresol púrpura; solución de conductividad HI7030; solución de hibridación; solución de KOH; solución de lisis; solución lisozima; solución de metabisulfito de sodio; solución de NaCl; Solución de NaOH; solución de papaína; solución de sarkosil; solución de lavado; solución de llenado; solución de telurito de potasio;

solución de verde brillante; solución de yodo-yoduro de potasio; solución electrolyte; solución indicadora de rojo de metilo; solución madre de proteinasa K; solución MgCl 2; solución neutralizante; solución para almacenaje de electrodos de pH; solución permanganato de potasio; solución reguladora de fosfatos; solución salina; solución SDS; sonda 1S711 FAM-AAGCCAACACCCGGCCATTATGGT-TAMRA; staphylococcus aureus ATCC 29923; suspensión de bacillus stearathermophillus; subcontratación de pruebas para la determinación de enterotoxinas estafilococcicas y para la determinación de florecimiento algar nocivo; subcontratación de servicios con terceros; suero monovalente v. cholerae 0139; suero monovalente v. cholerae Inaba; suero monovalente v. cholerae Ogawa; suero polivalente Vibrio cholerae; suplemento antimicrobiano de novobiocina para selectividad del medios de cultivo; suplemento de novobiocina; suplemento selectivo modificado para brucella; tabletas PBS-Calbiochem; tamiz; TBGA; tamón de acetato de amonio; tampón de carga; tampón TAE; tamó de TBE; tampón tris acetat-EDTA; tapa de microplaca, TDA (X2) reactivo para API20E; telurito de potasio; termobaño con recirculación de agua para coliformes fecales; termobloque; termociclador; termómetro; termohigrómetro ambiental trazable a Nist; termómetro infrarojo; tween 80; telurio de potasio; tijeras; tiosulfato de sodio; tapas optical 8-Cap Strip MicroAmp para microtubos MicroAmp fast reaction; tinas de plástico con tapa; tira indicadora de pH; tiras de 8 tapas óptical; tiras de 8 tubos; tiras API 20E Biomerieux; tiras de diagnóstico; tiras reactivas de pH; toallas limpiadoras; transiluminador; triptona; tris base; TRIS (Hidroxiximetilaminometano); tritón X-100; tubo para PCR; tubo de ensayo; tubo de hule látex para conexión de gas al mechero; tubos FAST para ABI 7500 FAST para PCR tiempo real; tubos cónicos; tubos; tubos de cultivo; tubos de ensayo; tubos de fermentación; tubos de cultivo; tubos de polipropileno; tubos de vidrio con tapas de rosca de baquelita; tubos para centrifuga de polipropileno; tubos para serología; ultracongelador; unidad filtradora tipo pirinola; UPS para equipos; utensilio para muestreo; varillas acodadas en ángulo recto y en forma de V; varillas de vidrio; vaso de licuadora; vaso de precipitados; verde malaquita; verneier o medidor de halos;

viales con tapa para engargolar; viales; vibrio por PCR PRIMER TDH FWD y PCR PRIMER TDH REV; vórtex; yodo en cristales; yoduro de potasio; zapatos de seguridad. Agar SIM, Agar ASTEL, Agar azul de toluidina, Agar Baird-Parker, Agar BCYE, Agar Cetrimida, Agar Citrato de Simmon, Agar Columbia, Agar Cuenta estándar, Agar de Hierro Kligler (KIA), Agar Hierro-Lisina (LIA), Agar Dextrosa Sabouraud, Agar eosina azul de metileno de Levin (EMB-L), Agar Entérico de Hektoen, Agar Eosina Azul de Metileno (AEMB), Agar Extracto de Malta, Agar Glucosa Rojo Violeta Billis, Agar GVPC, Agar Hígado de Ternera, Agar Indicador PM, Agar Letheen modificado, Agar MacConkey, Agar modificado con Celobiosa, Polimixina B y Colistina (mCPC), Agar Movilidad, Agar Mueller-Hinton, Agar Neutralizante, Agar Nutritivo, Agar Oxford, Agar PALCAM, Agar Papa Dextrosa, Agar para antibióticos #1, Agar para antibióticos #10, Agar para antibióticos #11, Agar para antibióticos #19, Agar para antibióticos #2, Agar para antibióticos #32, ,

Agar para antibióticos #35, Agar para antibióticos #36, Agar para antibióticos #4, Agar para antibióticos #40, Agar para antibióticos #5, Agar para antibióticos #8, Agar para antibióticos #9, Agar Sal Manitol, Agar Sangre de Cordero, Agar Soya Tripticaseína (T.S.A.), Agar sulfito de bismuto (ASB), Agar Swarm, Agar T1N1 (Agar Triptona y Sal), Agar TBX, Agar tiosulfato de sodio Citrato sales biliares sacarosa (TCBS), Agar Urea de Christensen, Agar Verde Brillante, Agar Vogel Jhonson, Agar Xilosa Lisina Desoxicolato, Agar-hierro-triple azúcar (TSI), Agua Peptonada, Agua Peptonada Alcalina (APA), Agua Peptonada Amortiguada, Buffer de Extracción, Caldo A1, Caldo Ácido, Caldo Carbohidratos (Ramnosa y Xilosa), Caldo Carne Cocida, Caldo Cerebro Corazón, Caldo Citrato de Koser, Caldo CSTEL, Caldo Dextrosa Sabouraud, Caldo EC, Caldo Extracto de Malta, Caldo Fraser Completo, Caldo Fraser Medio, Caldo Glucosa Purpura de Bromocresol, Caldo glutamato con minerales modificado (MMGB), Caldo Lactosa Billis Verde Brillante, Caldo Lactosado, Caldo Lauril Triptosa, Caldo Lauril Triptosa con MUG, Caldo Letheen modificado, Caldo L-lisina descarboxilasa, Caldo MacConkey, Caldo Mossel de enriquecimiento para enterobacterias, Caldo MR-VP, Caldo Muller Kauffmann Tetrationato, Caldo Neutralizante

Caldo Nitrato, Caldo para antibioticos #13, Caldo para antibioticos #3, Caldo para antibioticos #34, Caldo para antibioticos #39, Caldo para antibioticos #41, Caldo Rappaport-Vassiliadis, Caldo Rojo de Fenol, Agar Soya Tripticaseína (T.S.A.), Agar Soya Tripticasa (AST), Caldo Tioglicolato, Caldo Triptona y Caldos Triptona Sal T1N0,T1N1,T1N3 y T1N6,T1N8 y T1N10, Medio de enriquecimiento para Clostrodios, Reactivo Azul de Bromotimol, Reactivo de Kovacs, Reactivo de -Galactosidasa, Reactivos para la prueba de Voges-Proskauer (VP), Reactivos para la reacción de Indol, Reactivos para la tinción de Gram, Sauton diluido, Solución amortiguadora 10% pH 6.0±0.05, Solución amortiguadora al 1% pH 6.0±0.05, Solución de peptona y extracto de carne con polisorbato 80, Solución Neutralizante Concentrada, Solución Neutralizante Diluida, Solución Peptonada con polisorbato, Solución Reguladora de Fosfatos, Solución Reguladora de Fosfatos pH 6, Solución salina amortiguadora de fosfatos (PBS), Solución salina fisiológica, Triton X

LESP

10. Realizar el análisis del número de determinaciones establecidas para agua (coliformes fecales) en áreas de cosecha de moluscos bivalvos (LESP).

21601; 25101; 25501; 25901; 27201; 33901; 32401; 53101; 53201.

MATERIAL DE LIMPIEZA; PRODUCTOS QUÍMICOS BÁSICOS; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; OTROS PRODUCTOS QUÍMICOS; PRENDAS DE PROTECCIÓN PERSONAL; SUBCTONTRATACIÓN DE SERVICIOS CON TERCEROS; ARRENDAMIENTO DE EQUIPO E INSTRUMENTAL MÉDICO Y DE LABORATORIO; EQUIPO MÉDICO Y DE LABORATORIO; INSTRUMENTAL MÉDICO Y DE LABORATORIO.

Cinta canela/cinta testigo; frasco con tapa; termómetro; medidor de ph; incubadora; agar eosina azul de metileno de Levin; agar nutritivo; agua peptonada asas bacteriológicas; balanza de precisión; balanza granataria; bolsas de polietileno para homogeneizador peristáltico; botellas con tapa de rosca; caja petri estéril; alcohol o solución desinfectante; baño de agua con recirculación y tapa; bioindicador esterikon; bulbos; pro pipetas; micropipetas; Caldo A1; Caldo EC; Caldo Lactosado; Caldo lauril sulfato con MUG; Caldo Lauril Triptosa; Caldo Lauril Triptosa con MUG; Caldo M-Endo; Caldo verde brillante lactosa bilis; Diluyente de Peptona, E.coli ATCC 25922, Embudos de filtración de PVC, Enterobacter aerogenes ATCC 13048, Fosfato de potasio monobásico, Gradillas, Klebsiella pneumoniae ATCC 13883, Licuadora, vasos Licuadoras; Marco de pesas; Matraz; Mecheros Bunsen; Medidor de pH; Pipetas bacteriológicas; Pipetas graduadas; Reactivo de Kovacs; Reactivos para la coloración de GRAM; Solución estándar; Staphylococcus aureus ATCC 25923; Staphylococcus aureus ATCC 29923; Tubos de cultivo con tapón de rosca; Tubos de fermentación; Tubos de fermentación invertidos (Durham); Tubos de ensayo con tapa de rosca o quita pon de acero inoxidable; baquelita o plástico inerte.

11. Realizar el análisis del número de determinaciones establecidas para producto (E. coli, Salmonella sp, Vibrio cholerae y Vibrio parahaemolyticus incluye gastos de toma y envío de muestras y reporte de resultados) en áreas de cosecha de moluscos bivalvos (LESP).

21601; 25101; 25501; 25901; 27201; 33901; 32401; 53101; 53201.

MATERIAL DE LIMPIEZA; PRODUCTOS QUÍMICOS BÁSICOS; MATERIALES, ACCESORIOS Y SUMINISTROS DE LABORATORIO; OTROS PRODUCTOS QUÍMICOS; PRENDAS DE PROTECCIÓN PERSONAL; SUBCTONTRATACIÓN DE SERVICIOS CON TERCEROS; ARRENDAMIENTO DE EQUIPO E INSTRUMENTAL MÉDICO Y DE LABORATORIO; EQUIPO MÉDICO Y DE LABORATORIO; INSTRUMENTAL MÉDICO Y DE LABORATORIO.

Aceite de inmersión; ácido clorhídrico HCl; agar bacteriológico; agar base sangre; agar bilis glucuronido (TBGA); agar bilis rojo violeta (RVBA); agar celobiosa polimixina colistina modificado mCPC; agar Citrato de Simmon; agar cromogénico; agar cuenta estándar; agar de hierro kligler (KIA); agar eosina azul de metileno de Levin (EMB-L); agar hektoen entérico (AHE); agar hierro triple azúcares (TSI); agar hierro-lisina (LIA); agar inclinado arginina glucosa; agar MacConkey; agar medio movilidad; agar métodos cuenta estándar; agar nutritivo; agar sabouraud con dextrosa; agar sacarosa V. parahaemolyticus (VPSA); agar sangre; agar SIM; agar soya tripticasa (AST); sulfato de magnesio; agar soya tripticaseína (T.S.A.); agar sulfito de bismuto (ASB); agar T1N1 y T1N3; agar tiosulfato de sodio; agar tiosulfato de sodio citrato sales biliares sacarosa (TCBS); agar triptona bilis X-Glucoronido; agar triptosa, base de sangre; agar urea de christensen; agar verde brillante (AVB); agar xilosa lisina desoxicolato (XLD); agarosa; agua destilada; agua grado biología molecular; agua peptonada alcalina (APA); agua tipo 1; ampolletas bioindicadoras; Anti-Dig AP [Anti-digoxigenina fosfatasa alcalina, antisuero de conejo policlonal liofilizado; antisuero de Vibrio cholerae O139; antisuero monoespecífico salmonella O: B,C,D,E,F,G,H,I; antisuero monovalente Inaba; antisuero monovalente Ogawa; antisuero monovalente Vibrio cholerae Ogawa; antisuero para Vibrio Cholerae Ogawa; antisuero polivalente de V. cholerae O1; antisuero polivalente o salmonella poly B,C,D, BD DIFCO; antisuero polivalente O:A-I+Vi; antisuero somático (O) polivalente; antisuero Vibrio cholerae polivalente; asas bacteriológicas; asas de nicromel; asas de platino-iridio; asas de poliestireno; asas desechables; autoclave; auxiliar de macropipeteado; balanza granataria; baño de agua; base descarboxilasa de Moeller; base Moeller descarboxilasa; batas de cirujano; bioindicador Sterikon plus; bioquímicas miniaturizadas API 20 E; bolsas de papel para esterilizar material; bolsas de plástico estériles; bolsas de polietileno para homogeneizador peristáltico; bomba de vacío; bote de polipropileno blanco, con tapa de rosca, autoclavable; botella de dilución de vidrio de borosilicato con tapa de rosca; botellas con tapa de rosca; botellas; bromuro de etidio; buffer de referencia estándar pH;

buffer salino de fosfatos (PBS); cadena de la polimerasa (PCR); caja de esterilización cuadrada de aluminio para pipetas; cajas de petri con relieve; cajas de petri desechable sin división; cajas petri; caldo base de Muller, descarboxilasa; caldo carbohidrato (ramnosa y xilosa); caldo cianuro de potasio (KCN); caldo citrato de Kosher; caldo Dey-Engley; caldo EC (E. coli) MUG; caldo glutamato con minerales modificado (MMGB); caldo infusión, cerebro corazón (BHI); caldo lactosado; caldo lauril triptosa; caldo lauril triptosa con MUG; caldo lauril sulfato de sodio; caldo L-lisina decarboxilasa; caldo malonato; caldo mineral modificado con glutamato; caldo MR-VP; caldo Muller-Kauffmann tetrationato-novobiocina (MKTTn); caldo nutritivo; caldo peptona de caseína; caldo peptonado; caldo púrpura para carbohidratos; caldo Rappaport-Vassiliadis; caldo rojo de fenol; caldo rojo de fenol para carbohidratos; caldo soya-tripticaseína con sulfato ferroso; caldo soya-tripticaseína-triptosa; caldo Tetrationato (CTT); caldo triptona; caldo triptona con cloruro de sodio; caldo Universal de preenriquecimiento; caldo verde brillante lactosa bilis; caldos T1N0, T1N3, T1N6, T1N8, T1N10; cámara de electroforesis; campana de bioseguridad; campana de extracción; campana de flujo laminar; campanas de Durham; celdas; cinta testigo; citrato de solución salina; citrato férrico; citrato férrico amónico; citrato sales biliares sacarosa (TCBS); cloruro de amonio; cloruro de benzalconio; cloruro de magnesio hexahidratado; cloruro de Sodio (NaCl); cristales, RA, ASC, TA; cofias; colorante púrpura de bromocresol (Polvo); colorante verde brillante (Polvo); congelador; cono de hilo de algodón para hisopo de Spira; cristales de fosfato de creatína; cristales de monohidrato de creatina; cubrebocas; cuchillos; cuchillos desconchadores; data loggers para autoclave; desconchadores; detergente alcalino y neutro para lavado de material de laboratorio; dexosicolato de sodio; dextrosa anhidra; digerido enzimático de caseína; digestor de muestras por microondas; diluyente peptona-tween-sal (PTS); dinucleótidos Trifosfato (dNTP's) 10mM cada uno dATP, dCTP, dGTP, dTTP; discos ONPG (o-nitrofenil--D-galactopiranosa); dispensador de líquidos; E. coli ATCC 25922 o ATCC 8739; E. fecalis ATCC 29212 o ATCC 19433; electrodo; electrodo combinado de pH; embudo de vidrio; enterobacter

aerogenes ATCC 13048; equipo de filtración por membrana; equipo medidor de pH; escalpelo de acero inoxidable; espátulas; espectrofotómetro UV-VIS; etanol, extracto de levadura; filtros de membrana; fosfato de Potasio Monobásico (KH2PO4); fosfato de sodio dibásico dodecahidratado (Na2HPO4.12H2O ); fosfato de sodio dibásico; fosfato de sodio monobásico; fosfato disódico anhidro dihidratado; frascos; frasco de plástic